Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606814258:

Variant ID: vg0606814258 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 6814258
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTTAAGTAAAATCATACTTAAAAAAAATATGATTTTGTTTGGATGCTAGCCGCGCAATTGTGCAGGCCACCCAGCTAGTTCTTTTTACAGGACAACA[G/A]
CCAATATGGGTGAAAATAGATCGGATAATATTCAATCTGATCTGCTTCGAAACCGTCCAAAATAAGGATATGCTATGGGATTTTAGAAATCCGGCGCACG

Reverse complement sequence

CGTGCGCCGGATTTCTAAAATCCCATAGCATATCCTTATTTTGGACGGTTTCGAAGCAGATCAGATTGAATATTATCCGATCTATTTTCACCCATATTGG[C/T]
TGTTGTCCTGTAAAAAGAACTAGCTGGGTGGCCTGCACAATTGCGCGGCTAGCATCCAAACAAAATCATATTTTTTTTAAGTATGATTTTACTTAAAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.80%	2.40%	0.87%	0.00%	NA
All Indica	2759	94.90%	3.70%	1.41%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	82.20%	11.20%	6.67%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	93.80%	5.20%	1.02%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	3.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0606814258	G -> A	LOC_Os06g12560.1	upstream_gene_variant ; 2295.0bp to feature; MODIFIER	silent_mutation	Average:47.617; most accessible tissue: Minghui63 flower, score: 69.893	N	N	N	N
vg0606814258	G -> A	LOC_Os06g12570.1	upstream_gene_variant ; 450.0bp to feature; MODIFIER	silent_mutation	Average:47.617; most accessible tissue: Minghui63 flower, score: 69.893	N	N	N	N
vg0606814258	G -> A	LOC_Os06g12580.1	downstream_gene_variant ; 2144.0bp to feature; MODIFIER	silent_mutation	Average:47.617; most accessible tissue: Minghui63 flower, score: 69.893	N	N	N	N
vg0606814258	G -> A	LOC_Os06g12560-LOC_Os06g12570	intergenic_region ; MODIFIER	silent_mutation	Average:47.617; most accessible tissue: Minghui63 flower, score: 69.893	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0606814258	NA	2.15E-08	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	2.00E-10	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	6.36E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	1.90E-06	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	1.61E-06	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	2.56E-09	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	3.15E-11	mr1122	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	5.77E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	1.59E-10	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	5.73E-09	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	4.08E-08	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	2.48E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	2.07E-10	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	6.57E-07	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	2.57E-08	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606814258	NA	1.97E-06	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251