Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606734750:

Variant ID: vg0606734750 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 6734750
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTAAATGAATGTGAACAATGCTAGAAAGTCTAGATTCATTAACATCTAAATGAATGTGGACAATGCTAGAAAGTCTAGATTCATTAACACCTAAATGAA[T/C]
GTGGACAATGCTAGAAAGTCTTATATTGTGAAACGGAGGGAATACTTTATTTCATCAATTCTATAACTCTATAATCTCATAACTGGGTGATAATTTGAAT

Reverse complement sequence

ATTCAAATTATCACCCAGTTATGAGATTATAGAGTTATAGAATTGATGAAATAAAGTATTCCCTCCGTTTCACAATATAAGACTTTCTAGCATTGTCCAC[A/G]
TTCATTTAGGTGTTAATGAATCTAGACTTTCTAGCATTGTCCACATTCATTTAGATGTTAATGAATCTAGACTTTCTAGCATTGTTCACATTCATTTAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.00%	0.50%	4.42%	17.10%	NA
All Indica	2759	71.80%	0.80%	6.67%	20.66%	NA
All Japonica	1512	99.70%	0.10%	0.07%	0.20%	NA
Aus	269	6.70%	0.00%	8.18%	85.13%	NA
Indica I	595	51.30%	1.70%	7.56%	39.50%	NA
Indica II	465	93.30%	0.20%	1.08%	5.38%	NA
Indica III	913	78.10%	0.30%	10.30%	11.28%	NA
Indica Intermediate	786	67.40%	1.10%	5.09%	26.34%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.20%	0.00%	0.40%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	92.20%	0.00%	2.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0606734750	T -> C	LOC_Os06g12410.1	upstream_gene_variant ; 1303.0bp to feature; MODIFIER	silent_mutation	Average:41.969; most accessible tissue: Callus, score: 69.646	N	N	N	N
vg0606734750	T -> C	LOC_Os06g12400.1	downstream_gene_variant ; 304.0bp to feature; MODIFIER	silent_mutation	Average:41.969; most accessible tissue: Callus, score: 69.646	N	N	N	N
vg0606734750	T -> C	LOC_Os06g12400-LOC_Os06g12410	intergenic_region ; MODIFIER	silent_mutation	Average:41.969; most accessible tissue: Callus, score: 69.646	N	N	N	N
vg0606734750	T -> DEL	N	N	silent_mutation	Average:41.969; most accessible tissue: Callus, score: 69.646	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0606734750	NA	1.15E-08	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	8.06E-06	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	3.70E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	4.83E-07	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	1.12E-07	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	2.62E-06	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	3.15E-06	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	2.36E-11	mr1275	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	2.98E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	1.90E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	3.69E-07	mr1367	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	9.27E-06	mr1394	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	9.46E-06	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	1.40E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	1.89E-09	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	4.65E-06	4.62E-06	mr1497	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	8.04E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	1.50E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	3.02E-07	mr1544	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	2.03E-07	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	3.51E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	1.43E-13	mr1607	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	3.23E-06	mr1607	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	5.17E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	7.97E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	2.35E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	9.53E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	8.09E-08	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	6.52E-09	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	4.67E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	6.60E-11	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	9.12E-07	mr1508_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606734750	NA	1.89E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251