Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606708075:

Variant ID: vg0606708075 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 6708075
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGAAATCTAAAAGTAATCTAGATATATTATAAAAGTAATTTATGATTTTTTATCAAAATATAATCATGTGAGATCTTGTTCTAAAGATTTAATTGTTAC[G/A]
AACACAACGATGCAATCGGATTGTAGATCGGATGAGTAATTTAAGAGAAAATTTTATTTGAAGCATAGATGATAGGAGTATTTGTTCTACATGCTTGATC

Reverse complement sequence

GATCAAGCATGTAGAACAAATACTCCTATCATCTATGCTTCAAATAAAATTTTCTCTTAAATTACTCATCCGATCTACAATCCGATTGCATCGTTGTGTT[C/T]
GTAACAATTAAATCTTTAGAACAAGATCTCACATGATTATATTTTGATAAAAAATCATAAATTACTTTTATAATATATCTAGATTACTTTTAGATTTCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.30%	1.00%	6.09%	5.61%	NA
All Indica	2759	84.20%	0.00%	8.99%	6.78%	NA
All Japonica	1512	94.30%	3.00%	2.25%	0.46%	NA
Aus	269	98.90%	0.00%	0.00%	1.12%	NA
Indica I	595	79.30%	0.00%	18.66%	2.02%	NA
Indica II	465	96.80%	0.00%	2.15%	1.08%	NA
Indica III	913	83.00%	0.00%	2.19%	14.79%	NA
Indica Intermediate	786	81.90%	0.00%	13.61%	4.45%	NA
Temperate Japonica	767	98.30%	0.30%	1.43%	0.00%	NA
Tropical Japonica	504	87.70%	8.30%	3.77%	0.20%	NA
Japonica Intermediate	241	95.40%	0.40%	1.66%	2.49%	NA
VI/Aromatic	96	33.30%	0.00%	5.21%	61.46%	NA
Intermediate	90	88.90%	0.00%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0606708075	G -> A	LOC_Os06g12370.1	upstream_gene_variant ; 3659.0bp to feature; MODIFIER	silent_mutation	Average:34.492; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0606708075	G -> A	LOC_Os06g12380.1	upstream_gene_variant ; 4403.0bp to feature; MODIFIER	silent_mutation	Average:34.492; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0606708075	G -> A	LOC_Os06g12370-LOC_Os06g12380	intergenic_region ; MODIFIER	silent_mutation	Average:34.492; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0606708075	G -> DEL	N	N	silent_mutation	Average:34.492; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0606708075	1.22E-06	6.62E-10	mr1676_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251