\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606569149:

Variant ID: vg0606569149 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 6569149
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTAGTGCAGTTGGTGTAGATTGGATCTATGTCGAGAGGTGCGGAGATCAGCAATGGAGTGGCTGATGGCACGTGTAATGGAGTGTGTGAGTAACTCTT[C/T]
AGGGTTCTTGCCGAAGCCCTTTATATAACGTTAGGGCTTCCGGCGGCATGCATGTCACAATATCCCTTATAATCTGGGTACGTGCAATCTATTTACATGG

Reverse complement sequence

CCATGTAAATAGATTGCACGTACCCAGATTATAAGGGATATTGTGACATGCATGCCGCCGGAAGCCCTAACGTTATATAAAGGGCTTCGGCAAGAACCCT[G/A]
AAGAGTTACTCACACACTCCATTACACGTGCCATCAGCCACTCCATTGCTGATCTCCGCACCTCTCGACATAGATCCAATCTACACCAACTGCACTAGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 15.20% 0.02% 0.00% NA
All Indica  2759 74.50% 25.50% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 70.50% 29.50% 0.00% 0.00% NA
Indica III  913 52.90% 47.10% 0.00% 0.00% NA
Indica Intermediate  786 83.60% 16.40% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606569149 C -> T LOC_Os06g12230.1 upstream_gene_variant ; 1629.0bp to feature; MODIFIER silent_mutation Average:54.929; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0606569149 C -> T LOC_Os06g12220-LOC_Os06g12230 intergenic_region ; MODIFIER silent_mutation Average:54.929; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606569149 NA 5.44E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 1.31E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 2.82E-06 mr1045 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 2.54E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 4.45E-06 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 5.19E-08 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 8.23E-06 8.23E-06 mr1377 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 3.83E-10 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 6.09E-09 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 2.33E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 1.23E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 7.63E-11 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 1.15E-10 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 1.83E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 5.80E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 9.72E-09 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 6.81E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 7.46E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 7.75E-11 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 1.47E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 8.82E-06 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 2.62E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 6.35E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 3.76E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 8.92E-07 1.32E-06 mr1499_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 7.76E-06 mr1499_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 8.74E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606569149 NA 1.72E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251