\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606550447:

Variant ID: vg0606550447 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 6550447
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCCTCCCACATTTTGAGCGAGTTAAGCTATTCCTCTCACCCTTAACCCAACTCCTTTAATTGGTCAAGAACACCACAACATGCAGTGGTTGAGATAGC[G/A]
TGGGGGCGGGGGTCTTTAGACCCCACTACCCCTAATAAACCATTAGAGCTCCCATAATACCCCCTAAAATTCTAATCCTCATGTGAGTCTAAGATAGACT

Reverse complement sequence

AGTCTATCTTAGACTCACATGAGGATTAGAATTTTAGGGGGTATTATGGGAGCTCTAATGGTTTATTAGGGGTAGTGGGGTCTAAAGACCCCCGCCCCCA[C/T]
GCTATCTCAACCACTGCATGTTGTGGTGTTCTTGACCAATTAAAGGAGTTGGGTTAAGGGTGAGAGGAATAGCTTAACTCGCTCAAAATGTGGGAGGAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 17.00% 0.51% 0.61% NA
All Indica  2759 71.30% 27.30% 0.43% 1.05% NA
All Japonica  1512 96.60% 2.80% 0.60% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 98.00% 1.00% 1.01% 0.00% NA
Indica II  465 65.60% 29.90% 0.22% 4.30% NA
Indica III  913 48.70% 51.20% 0.00% 0.11% NA
Indica Intermediate  786 80.50% 17.80% 0.64% 1.02% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 91.70% 6.90% 1.39% 0.00% NA
Japonica Intermediate  241 98.30% 0.80% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606550447 G -> A LOC_Os06g12200-LOC_Os06g12210 intergenic_region ; MODIFIER silent_mutation Average:35.964; most accessible tissue: Zhenshan97 flower, score: 90.915 N N N N
vg0606550447 G -> DEL N N silent_mutation Average:35.964; most accessible tissue: Zhenshan97 flower, score: 90.915 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0606550447 G A -0.04 -0.02 -0.02 -0.02 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606550447 NA 2.54E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606550447 NA 2.40E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606550447 2.47E-06 2.47E-06 mr1239 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606550447 NA 3.49E-07 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606550447 7.79E-06 7.78E-06 mr1377 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606550447 NA 6.80E-08 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606550447 NA 9.71E-06 mr1504 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606550447 NA 1.05E-14 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606550447 NA 4.85E-11 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606550447 NA 5.80E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606550447 NA 9.74E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606550447 NA 9.39E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606550447 NA 5.80E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251