Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0606463096:

Variant ID: vg0606463096 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 6463096
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAATCTCCTGAAGATGAAGTTGAAGATAAAGTTTAAGTGTTTCTCGTAAAACGAGGTGGTAATAACGTGTGATTAATTGAGTTTTAATTATTACAAACTT[G/A]
AAAATTGGATTAATATGATATTTTAGAACAACTGCTAATATAGTTCATTAGGTATTTTGCCGGCACAGCTAGAAGAACATGGGTCAGCTAGTCGTCGAAC

Reverse complement sequence

GTTCGACGACTAGCTGACCCATGTTCTTCTAGCTGTGCCGGCAAAATACCTAATGAACTATATTAGCAGTTGTTCTAAAATATCATATTAATCCAATTTT[C/T]
AAGTTTGTAATAATTAAAACTCAATTAATCACACGTTATTACCACCTCGTTTTACGAGAAACACTTAAACTTTATCTTCAACTTCATCTTCAGGAGATTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	5.80%	3.00%	0.59%	NA
All Indica	2759	96.90%	0.70%	1.85%	0.62%	NA
All Japonica	1512	81.50%	15.60%	2.91%	0.00%	NA
Aus	269	78.80%	1.10%	15.99%	4.09%	NA
Indica I	595	94.50%	0.00%	4.87%	0.67%	NA
Indica II	465	98.90%	0.20%	0.43%	0.43%	NA
Indica III	913	99.00%	0.00%	0.22%	0.77%	NA
Indica Intermediate	786	95.00%	2.20%	2.29%	0.51%	NA
Temperate Japonica	767	94.70%	1.80%	3.52%	0.00%	NA
Tropical Japonica	504	56.90%	40.70%	2.38%	0.00%	NA
Japonica Intermediate	241	90.90%	7.10%	2.07%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	82.20%	13.30%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0606463096	G -> A	LOC_Os06g12050.1	upstream_gene_variant ; 3529.0bp to feature; MODIFIER	silent_mutation	Average:68.301; most accessible tissue: Callus, score: 78.351	N	N	N	N
vg0606463096	G -> A	LOC_Os06g12070.1	downstream_gene_variant ; 2501.0bp to feature; MODIFIER	silent_mutation	Average:68.301; most accessible tissue: Callus, score: 78.351	N	N	N	N
vg0606463096	G -> A	LOC_Os06g12060.1	intron_variant ; MODIFIER	silent_mutation	Average:68.301; most accessible tissue: Callus, score: 78.351	N	N	N	N
vg0606463096	G -> DEL	N	N	silent_mutation	Average:68.301; most accessible tissue: Callus, score: 78.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0606463096	NA	8.82E-06	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096	NA	2.19E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096	NA	1.83E-07	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096	NA	3.21E-07	mr1174_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096	NA	1.14E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096	NA	2.66E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096	1.71E-06	NA	mr1631_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096	NA	1.74E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096	NA	5.23E-12	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096	NA	9.59E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096	NA	1.69E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251