Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606463096:

Variant ID: vg0606463096 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 6463096
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATCTCCTGAAGATGAAGTTGAAGATAAAGTTTAAGTGTTTCTCGTAAAACGAGGTGGTAATAACGTGTGATTAATTGAGTTTTAATTATTACAAACTT[G/A]
AAAATTGGATTAATATGATATTTTAGAACAACTGCTAATATAGTTCATTAGGTATTTTGCCGGCACAGCTAGAAGAACATGGGTCAGCTAGTCGTCGAAC

Reverse complement sequence

GTTCGACGACTAGCTGACCCATGTTCTTCTAGCTGTGCCGGCAAAATACCTAATGAACTATATTAGCAGTTGTTCTAAAATATCATATTAATCCAATTTT[C/T]
AAGTTTGTAATAATTAAAACTCAATTAATCACACGTTATTACCACCTCGTTTTACGAGAAACACTTAAACTTTATCTTCAACTTCATCTTCAGGAGATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 5.80% 3.00% 0.59% NA
All Indica  2759 96.90% 0.70% 1.85% 0.62% NA
All Japonica  1512 81.50% 15.60% 2.91% 0.00% NA
Aus  269 78.80% 1.10% 15.99% 4.09% NA
Indica I  595 94.50% 0.00% 4.87% 0.67% NA
Indica II  465 98.90% 0.20% 0.43% 0.43% NA
Indica III  913 99.00% 0.00% 0.22% 0.77% NA
Indica Intermediate  786 95.00% 2.20% 2.29% 0.51% NA
Temperate Japonica  767 94.70% 1.80% 3.52% 0.00% NA
Tropical Japonica  504 56.90% 40.70% 2.38% 0.00% NA
Japonica Intermediate  241 90.90% 7.10% 2.07% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 82.20% 13.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606463096 G -> A LOC_Os06g12050.1 upstream_gene_variant ; 3529.0bp to feature; MODIFIER silent_mutation Average:68.301; most accessible tissue: Callus, score: 78.351 N N N N
vg0606463096 G -> A LOC_Os06g12070.1 downstream_gene_variant ; 2501.0bp to feature; MODIFIER silent_mutation Average:68.301; most accessible tissue: Callus, score: 78.351 N N N N
vg0606463096 G -> A LOC_Os06g12060.1 intron_variant ; MODIFIER silent_mutation Average:68.301; most accessible tissue: Callus, score: 78.351 N N N N
vg0606463096 G -> DEL N N silent_mutation Average:68.301; most accessible tissue: Callus, score: 78.351 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606463096 NA 8.82E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096 NA 2.19E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096 NA 1.83E-07 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096 NA 3.21E-07 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096 NA 1.14E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096 NA 2.66E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096 1.71E-06 NA mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096 NA 1.74E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096 NA 5.23E-12 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096 NA 9.59E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606463096 NA 1.69E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251