Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606307455:

Variant ID: vg0606307455 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 6307455
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAAAACTTGTTCTATCAAACGCAACCTAAGTCTATAACTACCCATAGAGCGGAAATATATCCTCTTGTTACTATTCTATAACTTTAAATAGTTGACAT[G/A]
CGGGTTGAACAAGTGAACCCGCATATATTAGAACACACGTTCTATTCAGATGTTTTGGCGTGTTACATCAGATATACGGACATACATTTGAAATTTGAAG

Reverse complement sequence

CTTCAAATTTCAAATGTATGTCCGTATATCTGATGTAACACGCCAAAACATCTGAATAGAACGTGTGTTCTAATATATGCGGGTTCACTTGTTCAACCCG[C/T]
ATGTCAACTATTTAAAGTTATAGAATAGTAACAAGAGGATATATTTCCGCTCTATGGGTAGTTATAGACTTAGGTTGCGTTTGATAGAACAAGTTTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.40%	46.60%	0.06%	0.00%	NA
All Indica	2759	42.10%	57.80%	0.04%	0.00%	NA
All Japonica	1512	78.90%	21.10%	0.00%	0.00%	NA
Aus	269	7.40%	92.20%	0.37%	0.00%	NA
Indica I	595	38.50%	61.50%	0.00%	0.00%	NA
Indica II	465	56.60%	43.20%	0.22%	0.00%	NA
Indica III	913	37.90%	62.10%	0.00%	0.00%	NA
Indica Intermediate	786	41.20%	58.80%	0.00%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	46.40%	53.60%	0.00%	0.00%	NA
Japonica Intermediate	241	84.60%	15.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	60.00%	38.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0606307455	G -> A	LOC_Os06g11860.1	upstream_gene_variant ; 794.0bp to feature; MODIFIER	silent_mutation	Average:52.664; most accessible tissue: Zhenshan97 flower, score: 79.026	N	N	N	N
vg0606307455	G -> A	LOC_Os06g11870.1	downstream_gene_variant ; 2470.0bp to feature; MODIFIER	silent_mutation	Average:52.664; most accessible tissue: Zhenshan97 flower, score: 79.026	N	N	N	N
vg0606307455	G -> A	LOC_Os06g11860-LOC_Os06g11870	intergenic_region ; MODIFIER	silent_mutation	Average:52.664; most accessible tissue: Zhenshan97 flower, score: 79.026	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0606307455	NA	2.78E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	NA	3.01E-06	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	NA	5.35E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	2.64E-06	2.64E-06	mr1159_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	NA	4.32E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	NA	7.76E-06	mr1397_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	5.59E-06	5.58E-06	mr1506_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	NA	1.50E-06	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	NA	8.59E-06	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	NA	1.01E-06	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	NA	7.66E-07	mr1764_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	NA	8.19E-07	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	8.37E-07	8.37E-07	mr1811_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	NA	2.79E-06	mr1812_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	NA	4.38E-06	mr1816_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	8.97E-06	8.97E-06	mr1832_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	6.44E-06	6.43E-06	mr1843_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455	NA	3.36E-06	mr1870_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251