\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606307455:

Variant ID: vg0606307455 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 6307455
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAAAACTTGTTCTATCAAACGCAACCTAAGTCTATAACTACCCATAGAGCGGAAATATATCCTCTTGTTACTATTCTATAACTTTAAATAGTTGACAT[G/A]
CGGGTTGAACAAGTGAACCCGCATATATTAGAACACACGTTCTATTCAGATGTTTTGGCGTGTTACATCAGATATACGGACATACATTTGAAATTTGAAG

Reverse complement sequence

CTTCAAATTTCAAATGTATGTCCGTATATCTGATGTAACACGCCAAAACATCTGAATAGAACGTGTGTTCTAATATATGCGGGTTCACTTGTTCAACCCG[C/T]
ATGTCAACTATTTAAAGTTATAGAATAGTAACAAGAGGATATATTTCCGCTCTATGGGTAGTTATAGACTTAGGTTGCGTTTGATAGAACAAGTTTTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 46.60% 0.06% 0.00% NA
All Indica  2759 42.10% 57.80% 0.04% 0.00% NA
All Japonica  1512 78.90% 21.10% 0.00% 0.00% NA
Aus  269 7.40% 92.20% 0.37% 0.00% NA
Indica I  595 38.50% 61.50% 0.00% 0.00% NA
Indica II  465 56.60% 43.20% 0.22% 0.00% NA
Indica III  913 37.90% 62.10% 0.00% 0.00% NA
Indica Intermediate  786 41.20% 58.80% 0.00% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 46.40% 53.60% 0.00% 0.00% NA
Japonica Intermediate  241 84.60% 15.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606307455 G -> A LOC_Os06g11860.1 upstream_gene_variant ; 794.0bp to feature; MODIFIER silent_mutation Average:52.664; most accessible tissue: Zhenshan97 flower, score: 79.026 N N N N
vg0606307455 G -> A LOC_Os06g11870.1 downstream_gene_variant ; 2470.0bp to feature; MODIFIER silent_mutation Average:52.664; most accessible tissue: Zhenshan97 flower, score: 79.026 N N N N
vg0606307455 G -> A LOC_Os06g11860-LOC_Os06g11870 intergenic_region ; MODIFIER silent_mutation Average:52.664; most accessible tissue: Zhenshan97 flower, score: 79.026 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606307455 NA 2.78E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 NA 3.01E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 NA 5.35E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 2.64E-06 2.64E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 NA 4.32E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 NA 7.76E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 5.59E-06 5.58E-06 mr1506_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 NA 1.50E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 NA 8.59E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 NA 1.01E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 NA 7.66E-07 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 NA 8.19E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 8.37E-07 8.37E-07 mr1811_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 NA 2.79E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 NA 4.38E-06 mr1816_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 8.97E-06 8.97E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 6.44E-06 6.43E-06 mr1843_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606307455 NA 3.36E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251