\
| Variant ID: vg0606257601 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 6257601 |
| Reference Allele: A | Alternative Allele: C,G |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTGAGCTCCTCAGCCTCTCCACCCCACGAGACCAATGCCACCTATGCTAGTCCCAACAGTGGGAGGGAAACACCGCCACCGCCACCGCCGTGGGCTTCCC[A/C,G]
CCGGCTATGGAGCTATGACGCCCACGGAAGCCTTAGCCGCCACCACCTCCTCTGTCGAGATGGCCTCCCGCCACCCCTTGCCAGTACCTGCTGTCCATAT
ATATGGACAGCAGGTACTGGCAAGGGGTGGCGGGAGGCCATCTCGACAGAGGAGGTGGTGGCGGCTAAGGCTTCCGTGGGCGTCATAGCTCCATAGCCGG[T/G,C]
GGGAAGCCCACGGCGGTGGCGGTGGCGGTGTTTCCCTCCCACTGTTGGGACTAGCATAGGTGGCATTGGTCTCGTGGGGTGGAGAGGCTGAGGAGCTCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.80% | 39.10% | 0.00% | 0.00% | G: 0.06% |
| All Indica | 2759 | 81.00% | 18.90% | 0.00% | 0.00% | G: 0.07% |
| All Japonica | 1512 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.60% | 0.00% | 0.00% | G: 0.37% |
| Indica I | 595 | 68.20% | 31.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.20% | 20.60% | 0.00% | 0.00% | G: 0.22% |
| Indica Intermediate | 786 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 54.00% | 46.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.40% | 82.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0606257601 | A -> C | LOC_Os06g11812.1 | upstream_gene_variant ; 3084.0bp to feature; MODIFIER | silent_mutation | Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 | N | N | N | N |
| vg0606257601 | A -> C | LOC_Os06g11800.1 | downstream_gene_variant ; 3893.0bp to feature; MODIFIER | silent_mutation | Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 | N | N | N | N |
| vg0606257601 | A -> C | LOC_Os06g11820.1 | downstream_gene_variant ; 849.0bp to feature; MODIFIER | silent_mutation | Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 | N | N | N | N |
| vg0606257601 | A -> C | LOC_Os06g11830.1 | downstream_gene_variant ; 831.0bp to feature; MODIFIER | silent_mutation | Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 | N | N | N | N |
| vg0606257601 | A -> C | LOC_Os06g11820-LOC_Os06g11830 | intergenic_region ; MODIFIER | silent_mutation | Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 | N | N | N | N |
| vg0606257601 | A -> G | LOC_Os06g11812.1 | upstream_gene_variant ; 3084.0bp to feature; MODIFIER | silent_mutation | Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 | N | N | N | N |
| vg0606257601 | A -> G | LOC_Os06g11800.1 | downstream_gene_variant ; 3893.0bp to feature; MODIFIER | silent_mutation | Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 | N | N | N | N |
| vg0606257601 | A -> G | LOC_Os06g11820.1 | downstream_gene_variant ; 849.0bp to feature; MODIFIER | silent_mutation | Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 | N | N | N | N |
| vg0606257601 | A -> G | LOC_Os06g11830.1 | downstream_gene_variant ; 831.0bp to feature; MODIFIER | silent_mutation | Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 | N | N | N | N |
| vg0606257601 | A -> G | LOC_Os06g11820-LOC_Os06g11830 | intergenic_region ; MODIFIER | silent_mutation | Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0606257601 | NA | 5.92E-06 | mr1294_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606257601 | NA | 8.76E-07 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606257601 | 7.36E-06 | 7.36E-06 | mr1418_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606257601 | 2.52E-06 | 2.52E-06 | mr1419_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606257601 | NA | 1.21E-06 | mr1420_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606257601 | 1.51E-06 | 1.51E-06 | mr1488_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606257601 | NA | 2.29E-07 | mr1579_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606257601 | NA | 9.36E-06 | mr1779_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606257601 | NA | 3.51E-07 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606257601 | NA | 1.52E-06 | mr1824_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |