\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606257601:

Variant ID: vg0606257601 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 6257601
Reference Allele: AAlternative Allele: C,G
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGAGCTCCTCAGCCTCTCCACCCCACGAGACCAATGCCACCTATGCTAGTCCCAACAGTGGGAGGGAAACACCGCCACCGCCACCGCCGTGGGCTTCCC[A/C,G]
CCGGCTATGGAGCTATGACGCCCACGGAAGCCTTAGCCGCCACCACCTCCTCTGTCGAGATGGCCTCCCGCCACCCCTTGCCAGTACCTGCTGTCCATAT

Reverse complement sequence

ATATGGACAGCAGGTACTGGCAAGGGGTGGCGGGAGGCCATCTCGACAGAGGAGGTGGTGGCGGCTAAGGCTTCCGTGGGCGTCATAGCTCCATAGCCGG[T/G,C]
GGGAAGCCCACGGCGGTGGCGGTGGCGGTGTTTCCCTCCCACTGTTGGGACTAGCATAGGTGGCATTGGTCTCGTGGGGTGGAGAGGCTGAGGAGCTCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.80% 39.10% 0.00% 0.00% G: 0.06%
All Indica  2759 81.00% 18.90% 0.00% 0.00% G: 0.07%
All Japonica  1512 21.90% 78.10% 0.00% 0.00% NA
Aus  269 94.10% 5.60% 0.00% 0.00% G: 0.37%
Indica I  595 68.20% 31.80% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 79.20% 20.60% 0.00% 0.00% G: 0.22%
Indica Intermediate  786 82.30% 17.70% 0.00% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 54.00% 46.00% 0.00% 0.00% NA
Japonica Intermediate  241 17.40% 82.60% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 56.70% 43.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606257601 A -> C LOC_Os06g11812.1 upstream_gene_variant ; 3084.0bp to feature; MODIFIER silent_mutation Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0606257601 A -> C LOC_Os06g11800.1 downstream_gene_variant ; 3893.0bp to feature; MODIFIER silent_mutation Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0606257601 A -> C LOC_Os06g11820.1 downstream_gene_variant ; 849.0bp to feature; MODIFIER silent_mutation Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0606257601 A -> C LOC_Os06g11830.1 downstream_gene_variant ; 831.0bp to feature; MODIFIER silent_mutation Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0606257601 A -> C LOC_Os06g11820-LOC_Os06g11830 intergenic_region ; MODIFIER silent_mutation Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0606257601 A -> G LOC_Os06g11812.1 upstream_gene_variant ; 3084.0bp to feature; MODIFIER silent_mutation Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0606257601 A -> G LOC_Os06g11800.1 downstream_gene_variant ; 3893.0bp to feature; MODIFIER silent_mutation Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0606257601 A -> G LOC_Os06g11820.1 downstream_gene_variant ; 849.0bp to feature; MODIFIER silent_mutation Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0606257601 A -> G LOC_Os06g11830.1 downstream_gene_variant ; 831.0bp to feature; MODIFIER silent_mutation Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0606257601 A -> G LOC_Os06g11820-LOC_Os06g11830 intergenic_region ; MODIFIER silent_mutation Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606257601 NA 5.92E-06 mr1294_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601 NA 8.76E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601 7.36E-06 7.36E-06 mr1418_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601 2.52E-06 2.52E-06 mr1419_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601 NA 1.21E-06 mr1420_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601 1.51E-06 1.51E-06 mr1488_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601 NA 2.29E-07 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601 NA 9.36E-06 mr1779_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601 NA 3.51E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601 NA 1.52E-06 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251