\
| Variant ID: vg0606129619 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 6129619 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCCAGGGGAGCTAAGGTAGCCATCCAACTCTTCCGTCGAGACTGTCCCAAGAGGTTGGAGTATAACGCCAACCTCTCTGGATCTAGATTGGATCGGGGCC[G/A]
AAGCCGGAGCTTGTCTAGATCTTCGAGTGGGAGATGTCTTGGCTGTGAAGACAGCGGCCAAATCATCAGGAAGTCTCATCAGGATTGAGGGATAGAACCC
GGGTTCTATCCCTCAATCCTGATGAGACTTCCTGATGATTTGGCCGCTGTCTTCACAGCCAAGACATCTCCCACTCGAAGATCTAGACAAGCTCCGGCTT[C/T]
GGCCCCGATCCAATCTAGATCCAGAGAGGTTGGCGTTATACTCCAACCTCTTGGGACAGTCTCGACGGAAGAGTTGGATGGCTACCTTAGCTCCCCTGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.10% | 4.50% | 8.29% | 0.11% | NA |
| All Indica | 2759 | 82.60% | 5.60% | 11.67% | 0.18% | NA |
| All Japonica | 1512 | 96.40% | 1.30% | 2.25% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.00% | 3.90% | 11.93% | 0.17% | NA |
| Indica II | 465 | 83.20% | 7.50% | 9.03% | 0.22% | NA |
| Indica III | 913 | 82.00% | 5.60% | 12.05% | 0.33% | NA |
| Indica Intermediate | 786 | 81.70% | 5.70% | 12.60% | 0.00% | NA |
| Temperate Japonica | 767 | 95.30% | 2.00% | 2.74% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 2.10% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 42.70% | 33.33% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0606129619 | G -> A | LOC_Os06g11560.1 | upstream_gene_variant ; 218.0bp to feature; MODIFIER | silent_mutation | Average:17.284; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg0606129619 | G -> A | LOC_Os06g11570.1 | upstream_gene_variant ; 2284.0bp to feature; MODIFIER | silent_mutation | Average:17.284; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg0606129619 | G -> A | LOC_Os06g11560-LOC_Os06g11570 | intergenic_region ; MODIFIER | silent_mutation | Average:17.284; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg0606129619 | G -> DEL | N | N | silent_mutation | Average:17.284; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0606129619 | 3.40E-06 | NA | mr1795 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606129619 | NA | 2.22E-06 | mr1795_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606129619 | NA | 1.79E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |