\
| Variant ID: vg0606016572 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 6016572 |
| Reference Allele: G | Alternative Allele: C,A |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCCACGTGGGATTGTCATTTGCCTTTTGCATACCAGTGCCATCAACGGTCATTAATATCTTCTTTTAAGAAAAAACTCAATACAAAAACATATTCTCTCT[G/C,A]
TCCTATAATATAAGGGATTTTGAGGTTTTTCTTACAATATTTGACCACTCGTCTTATTTAAAATTTTTTAAAATTATTATTTATTTTATTTGTAACTTAT
ATAAGTTACAAATAAAATAAATAATAATTTTAAAAAATTTTAAATAAGACGAGTGGTCAAATATTGTAAGAAAAACCTCAAAATCCCTTATATTATAGGA[C/G,T]
AGAGAGAATATGTTTTTGTATTGAGTTTTTTCTTAAAAGAAGATATTAATGACCGTTGATGGCACTGGTATGCAAAAGGCAAATGACAATCCCACGTGGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.80% | 20.10% | 0.02% | 0.00% | A: 0.04% |
| All Indica | 2759 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 73.10% | 26.80% | 0.00% | 0.00% | A: 0.13% |
| Aus | 269 | 3.00% | 96.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.70% | 14.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.30% | 11.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 33.30% | 66.30% | 0.00% | 0.00% | A: 0.40% |
| Japonica Intermediate | 241 | 73.40% | 26.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0606016572 | G -> C | LOC_Os06g11410.1 | upstream_gene_variant ; 3025.0bp to feature; MODIFIER | silent_mutation | Average:64.819; most accessible tissue: Callus, score: 96.478 | N | N | N | N |
| vg0606016572 | G -> C | LOC_Os06g11410.2 | upstream_gene_variant ; 3025.0bp to feature; MODIFIER | silent_mutation | Average:64.819; most accessible tissue: Callus, score: 96.478 | N | N | N | N |
| vg0606016572 | G -> C | LOC_Os06g11400-LOC_Os06g11410 | intergenic_region ; MODIFIER | silent_mutation | Average:64.819; most accessible tissue: Callus, score: 96.478 | N | N | N | N |
| vg0606016572 | G -> A | LOC_Os06g11410.1 | upstream_gene_variant ; 3025.0bp to feature; MODIFIER | silent_mutation | Average:64.819; most accessible tissue: Callus, score: 96.478 | N | N | N | N |
| vg0606016572 | G -> A | LOC_Os06g11410.2 | upstream_gene_variant ; 3025.0bp to feature; MODIFIER | silent_mutation | Average:64.819; most accessible tissue: Callus, score: 96.478 | N | N | N | N |
| vg0606016572 | G -> A | LOC_Os06g11400-LOC_Os06g11410 | intergenic_region ; MODIFIER | silent_mutation | Average:64.819; most accessible tissue: Callus, score: 96.478 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0606016572 | NA | 1.24E-10 | mr1530 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606016572 | NA | 2.41E-13 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606016572 | NA | 5.75E-15 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606016572 | NA | 3.27E-06 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606016572 | NA | 2.39E-10 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606016572 | NA | 3.09E-07 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606016572 | NA | 1.55E-19 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606016572 | NA | 1.09E-08 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606016572 | NA | 5.87E-12 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606016572 | NA | 5.97E-10 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606016572 | NA | 3.83E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606016572 | NA | 3.67E-07 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |