\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606016572:

Variant ID: vg0606016572 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 6016572
Reference Allele: GAlternative Allele: C,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCACGTGGGATTGTCATTTGCCTTTTGCATACCAGTGCCATCAACGGTCATTAATATCTTCTTTTAAGAAAAAACTCAATACAAAAACATATTCTCTCT[G/C,A]
TCCTATAATATAAGGGATTTTGAGGTTTTTCTTACAATATTTGACCACTCGTCTTATTTAAAATTTTTTAAAATTATTATTTATTTTATTTGTAACTTAT

Reverse complement sequence

ATAAGTTACAAATAAAATAAATAATAATTTTAAAAAATTTTAAATAAGACGAGTGGTCAAATATTGTAAGAAAAACCTCAAAATCCCTTATATTATAGGA[C/G,T]
AGAGAGAATATGTTTTTGTATTGAGTTTTTTCTTAAAAGAAGATATTAATGACCGTTGATGGCACTGGTATGCAAAAGGCAAATGACAATCCCACGTGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.80% 20.10% 0.02% 0.00% A: 0.04%
All Indica  2759 90.80% 9.20% 0.00% 0.00% NA
All Japonica  1512 73.10% 26.80% 0.00% 0.00% A: 0.13%
Aus  269 3.00% 96.70% 0.37% 0.00% NA
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 85.70% 14.30% 0.00% 0.00% NA
Indica Intermediate  786 88.30% 11.70% 0.00% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 33.30% 66.30% 0.00% 0.00% A: 0.40%
Japonica Intermediate  241 73.40% 26.60% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606016572 G -> C LOC_Os06g11410.1 upstream_gene_variant ; 3025.0bp to feature; MODIFIER silent_mutation Average:64.819; most accessible tissue: Callus, score: 96.478 N N N N
vg0606016572 G -> C LOC_Os06g11410.2 upstream_gene_variant ; 3025.0bp to feature; MODIFIER silent_mutation Average:64.819; most accessible tissue: Callus, score: 96.478 N N N N
vg0606016572 G -> C LOC_Os06g11400-LOC_Os06g11410 intergenic_region ; MODIFIER silent_mutation Average:64.819; most accessible tissue: Callus, score: 96.478 N N N N
vg0606016572 G -> A LOC_Os06g11410.1 upstream_gene_variant ; 3025.0bp to feature; MODIFIER silent_mutation Average:64.819; most accessible tissue: Callus, score: 96.478 N N N N
vg0606016572 G -> A LOC_Os06g11410.2 upstream_gene_variant ; 3025.0bp to feature; MODIFIER silent_mutation Average:64.819; most accessible tissue: Callus, score: 96.478 N N N N
vg0606016572 G -> A LOC_Os06g11400-LOC_Os06g11410 intergenic_region ; MODIFIER silent_mutation Average:64.819; most accessible tissue: Callus, score: 96.478 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606016572 NA 1.24E-10 mr1530 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606016572 NA 2.41E-13 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606016572 NA 5.75E-15 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606016572 NA 3.27E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606016572 NA 2.39E-10 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606016572 NA 3.09E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606016572 NA 1.55E-19 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606016572 NA 1.09E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606016572 NA 5.87E-12 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606016572 NA 5.97E-10 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606016572 NA 3.83E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606016572 NA 3.67E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251