Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605931332:

Variant ID: vg0605931332 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5931332
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTCGGAATTCCTTATATTTTTCCCCATATATCTGATTGGTTAAAATTTGTATGGATTTTTATGTATTCGGATCAGTGTTATAGAAATGGTCATAATAC[G/A]
GTGTAAATTTTAAATCCTAGAAATACTTATATTTTAAAACAGAGCGAGTAAATATCATTGTATAATAATAATTCAAACATGTAAAAGCATTATTTACGGC

Reverse complement sequence

GCCGTAAATAATGCTTTTACATGTTTGAATTATTATTATACAATGATATTTACTCGCTCTGTTTTAAAATATAAGTATTTCTAGGATTTAAAATTTACAC[C/T]
GTATTATGACCATTTCTATAACACTGATCCGAATACATAAAAATCCATACAAATTTTAACCAATCAGATATATGGGGAAAAATATAAGGAATTCCGAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.90%	2.00%	3.09%	0.00%	NA
All Indica	2759	91.80%	3.00%	5.15%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	90.30%	0.00%	9.75%	0.00%	NA
Indica II	465	86.70%	8.60%	4.73%	0.00%	NA
Indica III	913	98.50%	1.10%	0.44%	0.00%	NA
Indica Intermediate	786	88.30%	4.30%	7.38%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	3.30%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605931332	G -> A	LOC_Os06g11308.1	upstream_gene_variant ; 2453.0bp to feature; MODIFIER	silent_mutation	Average:63.454; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N
vg0605931332	G -> A	LOC_Os06g11320.1	downstream_gene_variant ; 2456.0bp to feature; MODIFIER	silent_mutation	Average:63.454; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N
vg0605931332	G -> A	LOC_Os06g11320.2	downstream_gene_variant ; 2457.0bp to feature; MODIFIER	silent_mutation	Average:63.454; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N
vg0605931332	G -> A	LOC_Os06g11310.1	intron_variant ; MODIFIER	silent_mutation	Average:63.454; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605931332	NA	9.97E-08	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	2.17E-07	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	4.36E-11	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	2.43E-07	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	1.86E-09	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	3.79E-10	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	2.99E-08	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	7.81E-09	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	2.09E-06	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	3.19E-06	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	1.40E-08	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	4.35E-08	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	6.23E-10	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	1.62E-06	3.42E-09	mr1889_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	2.66E-07	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	2.52E-06	4.42E-09	mr1934_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605931332	NA	2.26E-07	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251