Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0605885969:

Variant ID: vg0605885969 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5885969
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAGGAGGCCGCCGCTGGTGGCGCGCTGCGTGTAGTACAGCGCCGCGTGCGGCTGCGGCACGTTGCCGTAGGATCGGCACCGCGTCATCGGCGAGAGCA[G/C]
CACACGGTGGGAGAGATCGATCTTGCCGCCAGCCTGCTTGTACGGTGTCAGCAGCGGCATCGCGGCTTGGTTGACCATCTCGCCTCGGCCTTTCTCAACG

Reverse complement sequence

CGTTGAGAAAGGCCGAGGCGAGATGGTCAACCAAGCCGCGATGCCGCTGCTGACACCGTACAAGCAGGCTGGCGGCAAGATCGATCTCTCCCACCGTGTG[C/G]
TGCTCTCGCCGATGACGCGGTGCCGATCCTACGGCAACGTGCCGCAGCCGCACGCGGCGCTGTACTACACGCAGCGCGCCACCAGCGGCGGCCTCCTCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 10.40% 6.60% 0.00% NA
All Indica  2759 92.20% 2.10% 5.69% 0.00% NA
All Japonica  1512 62.40% 27.60% 9.92% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 76.50% 6.10% 17.48% 0.00% NA
Indica II  465 96.30% 1.50% 2.15% 0.00% NA
Indica III  913 99.50% 0.20% 0.33% 0.00% NA
Indica Intermediate  786 93.30% 1.70% 5.09% 0.00% NA
Temperate Japonica  767 45.60% 37.00% 17.34% 0.00% NA
Tropical Japonica  504 89.90% 8.90% 1.19% 0.00% NA
Japonica Intermediate  241 58.50% 36.90% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 14.40% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605885969 G -> C LOC_Os06g11210.1 missense_variant ; p.Leu27Val; MODERATE nonsynonymous_codon ; L27V Average:89.189; most accessible tissue: Zhenshan97 root, score: 99.137 benign -0.139 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0605885969 G C 0.04 0.07 0.03 0.03 0.05 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605885969 1.08E-06 NA mr1765 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251