\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605798825:

Variant ID: vg0605798825 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5798825
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATAACTTATGGCGTTTGAGTCCCAACAGTCATCCGTCATTTAATTTGTTTTCTCAAGTCATCCGTCATTTAATTTGTTTTCTCATTTTAGTTGTACGT[A/T]
CCCTCCCACCACCATTTAGGGAATGGATTCTAATCCGTCGAGAATGTCCTCTCATGTACATTTTTCTTACAATTTTCAAAAAATCATGTATATTTTTTTG

Reverse complement sequence

CAAAAAAATATACATGATTTTTTGAAAATTGTAAGAAAAATGTACATGAGAGGACATTCTCGACGGATTAGAATCCATTCCCTAAATGGTGGTGGGAGGG[T/A]
ACGTACAACTAAAATGAGAAAACAAATTAAATGACGGATGACTTGAGAAAACAAATTAAATGACGGATGACTGTTGGGACTCAAACGCCATAAGTTATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 3.80% 0.97% 0.00% NA
All Indica  2759 98.90% 0.60% 0.47% 0.00% NA
All Japonica  1512 87.40% 10.40% 2.18% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 0.00% 1.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.20% 0.70% 0.11% 0.00% NA
Indica Intermediate  786 98.10% 1.40% 0.51% 0.00% NA
Temperate Japonica  767 98.30% 0.00% 1.69% 0.00% NA
Tropical Japonica  504 66.50% 30.60% 2.98% 0.00% NA
Japonica Intermediate  241 96.70% 1.20% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605798825 A -> T LOC_Os06g11050.1 upstream_gene_variant ; 3015.0bp to feature; MODIFIER silent_mutation Average:42.379; most accessible tissue: Callus, score: 73.038 N N N N
vg0605798825 A -> T LOC_Os06g11060.1 upstream_gene_variant ; 1363.0bp to feature; MODIFIER silent_mutation Average:42.379; most accessible tissue: Callus, score: 73.038 N N N N
vg0605798825 A -> T LOC_Os06g11050-LOC_Os06g11060 intergenic_region ; MODIFIER silent_mutation Average:42.379; most accessible tissue: Callus, score: 73.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605798825 NA 3.01E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605798825 NA 9.64E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605798825 3.45E-07 1.31E-06 mr1037_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605798825 NA 3.66E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605798825 NA 8.78E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605798825 NA 2.38E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251