\
| Variant ID: vg0605739124 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5739124 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )
AGCACCATATTGTCAAATCATGATGCAATTAGGCTTAAAAGATTTGTCTCGTAATTCCTGGTGAACAACGTAATTATTTTTTTTTCTATATTTAATACTT[C/T]
ATGTATGTGTTTAAATATTTAATGTGACAGTATAAAAAATTTTGTTTGGGAAGTAAACAGGCCCTGAAACGAGTAGCACTGGAAAAGAAAATACAGATCA
TGATCTGTATTTTCTTTTCCAGTGCTACTCGTTTCAGGGCCTGTTTACTTCCCAAACAAAATTTTTTATACTGTCACATTAAATATTTAAACACATACAT[G/A]
AAGTATTAAATATAGAAAAAAAAATAATTACGTTGTTCACCAGGAATTACGAGACAAATCTTTTAAGCCTAATTGCATCATGATTTGACAATATGGTGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.00% | 3.70% | 2.35% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 3.50% | 3.95% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.70% | 10.60% | 9.75% | 0.00% | NA |
| Indica II | 465 | 97.00% | 1.30% | 1.72% | 0.00% | NA |
| Indica III | 913 | 98.40% | 0.10% | 1.53% | 0.00% | NA |
| Indica Intermediate | 786 | 93.00% | 3.30% | 3.69% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 32.30% | 67.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605739124 | C -> T | LOC_Os06g10980.1 | upstream_gene_variant ; 2971.0bp to feature; MODIFIER | silent_mutation | Average:39.563; most accessible tissue: Zhenshan97 flower, score: 59.202 | N | N | N | N |
| vg0605739124 | C -> T | LOC_Os06g10970.1 | downstream_gene_variant ; 4887.0bp to feature; MODIFIER | silent_mutation | Average:39.563; most accessible tissue: Zhenshan97 flower, score: 59.202 | N | N | N | N |
| vg0605739124 | C -> T | LOC_Os06g10980-LOC_Os06g10990 | intergenic_region ; MODIFIER | silent_mutation | Average:39.563; most accessible tissue: Zhenshan97 flower, score: 59.202 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605739124 | 3.37E-07 | 3.99E-16 | mr1201 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605739124 | 9.27E-09 | 2.22E-19 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605739124 | 6.15E-07 | 9.69E-12 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605739124 | 1.14E-08 | 1.50E-17 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605739124 | 4.15E-08 | 1.71E-11 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605739124 | 1.00E-09 | 7.25E-17 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605739124 | 6.20E-07 | 1.04E-12 | mr1201_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605739124 | 1.39E-08 | 1.88E-15 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605739124 | NA | 1.85E-09 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605739124 | 1.20E-06 | 4.07E-12 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605739124 | NA | 1.13E-09 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605739124 | 4.99E-06 | 6.58E-14 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |