Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0605739124:

Variant ID: vg0605739124 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5739124
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

AGCACCATATTGTCAAATCATGATGCAATTAGGCTTAAAAGATTTGTCTCGTAATTCCTGGTGAACAACGTAATTATTTTTTTTTCTATATTTAATACTT[C/T]
ATGTATGTGTTTAAATATTTAATGTGACAGTATAAAAAATTTTGTTTGGGAAGTAAACAGGCCCTGAAACGAGTAGCACTGGAAAAGAAAATACAGATCA

Reverse complement sequence

TGATCTGTATTTTCTTTTCCAGTGCTACTCGTTTCAGGGCCTGTTTACTTCCCAAACAAAATTTTTTATACTGTCACATTAAATATTTAAACACATACAT[G/A]
AAGTATTAAATATAGAAAAAAAAATAATTACGTTGTTCACCAGGAATTACGAGACAAATCTTTTAAGCCTAATTGCATCATGATTTGACAATATGGTGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.00%	3.70%	2.35%	0.00%	NA
All Indica	2759	92.60%	3.50%	3.95%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	79.70%	10.60%	9.75%	0.00%	NA
Indica II	465	97.00%	1.30%	1.72%	0.00%	NA
Indica III	913	98.40%	0.10%	1.53%	0.00%	NA
Indica Intermediate	786	93.00%	3.30%	3.69%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	32.30%	67.70%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605739124	C -> T	LOC_Os06g10980.1	upstream_gene_variant ; 2971.0bp to feature; MODIFIER	silent_mutation	Average:39.563; most accessible tissue: Zhenshan97 flower, score: 59.202	N	N	N	N
vg0605739124	C -> T	LOC_Os06g10970.1	downstream_gene_variant ; 4887.0bp to feature; MODIFIER	silent_mutation	Average:39.563; most accessible tissue: Zhenshan97 flower, score: 59.202	N	N	N	N
vg0605739124	C -> T	LOC_Os06g10980-LOC_Os06g10990	intergenic_region ; MODIFIER	silent_mutation	Average:39.563; most accessible tissue: Zhenshan97 flower, score: 59.202	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605739124	3.37E-07	3.99E-16	mr1201	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124	9.27E-09	2.22E-19	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124	6.15E-07	9.69E-12	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124	1.14E-08	1.50E-17	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124	4.15E-08	1.71E-11	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124	1.00E-09	7.25E-17	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124	6.20E-07	1.04E-12	mr1201_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124	1.39E-08	1.88E-15	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124	NA	1.85E-09	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124	1.20E-06	4.07E-12	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124	NA	1.13E-09	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124	4.99E-06	6.58E-14	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251