\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605739124:

Variant ID: vg0605739124 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5739124
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


AGCACCATATTGTCAAATCATGATGCAATTAGGCTTAAAAGATTTGTCTCGTAATTCCTGGTGAACAACGTAATTATTTTTTTTTCTATATTTAATACTT[C/T]
ATGTATGTGTTTAAATATTTAATGTGACAGTATAAAAAATTTTGTTTGGGAAGTAAACAGGCCCTGAAACGAGTAGCACTGGAAAAGAAAATACAGATCA

Reverse complement sequence

TGATCTGTATTTTCTTTTCCAGTGCTACTCGTTTCAGGGCCTGTTTACTTCCCAAACAAAATTTTTTATACTGTCACATTAAATATTTAAACACATACAT[G/A]
AAGTATTAAATATAGAAAAAAAAATAATTACGTTGTTCACCAGGAATTACGAGACAAATCTTTTAAGCCTAATTGCATCATGATTTGACAATATGGTGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 3.70% 2.35% 0.00% NA
All Indica  2759 92.60% 3.50% 3.95% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 79.70% 10.60% 9.75% 0.00% NA
Indica II  465 97.00% 1.30% 1.72% 0.00% NA
Indica III  913 98.40% 0.10% 1.53% 0.00% NA
Indica Intermediate  786 93.00% 3.30% 3.69% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605739124 C -> T LOC_Os06g10980.1 upstream_gene_variant ; 2971.0bp to feature; MODIFIER silent_mutation Average:39.563; most accessible tissue: Zhenshan97 flower, score: 59.202 N N N N
vg0605739124 C -> T LOC_Os06g10970.1 downstream_gene_variant ; 4887.0bp to feature; MODIFIER silent_mutation Average:39.563; most accessible tissue: Zhenshan97 flower, score: 59.202 N N N N
vg0605739124 C -> T LOC_Os06g10980-LOC_Os06g10990 intergenic_region ; MODIFIER silent_mutation Average:39.563; most accessible tissue: Zhenshan97 flower, score: 59.202 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605739124 3.37E-07 3.99E-16 mr1201 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124 9.27E-09 2.22E-19 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124 6.15E-07 9.69E-12 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124 1.14E-08 1.50E-17 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124 4.15E-08 1.71E-11 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124 1.00E-09 7.25E-17 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124 6.20E-07 1.04E-12 mr1201_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124 1.39E-08 1.88E-15 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124 NA 1.85E-09 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124 1.20E-06 4.07E-12 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124 NA 1.13E-09 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605739124 4.99E-06 6.58E-14 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251