\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605699431:

Variant ID: vg0605699431 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5699431
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTATTACGACCCATCAAATGAGGGGAGGGGAGAGGAGAGGGGAGGAGAGACGAGATAATTGGATGGGAAGTGAGAGGCAGCAAGGGGAGGGGGTGGAA[G/A]
TGATCAGGAGCGATGGGAGGGAGTCGCCATTCCGACGGGAAGTGAGGACATGCCCCATCAGAACGAGAGGGGGAAGCACGATCAAGGGACACATGCCAAA

Reverse complement sequence

TTTGGCATGTGTCCCTTGATCGTGCTTCCCCCTCTCGTTCTGATGGGGCATGTCCTCACTTCCCGTCGGAATGGCGACTCCCTCCCATCGCTCCTGATCA[C/T]
TTCCACCCCCTCCCCTTGCTGCCTCTCACTTCCCATCCAATTATCTCGTCTCTCCTCCCCTCTCCTCTCCCCTCCCCTCATTTGATGGGTCGTAATAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 2.90% 2.79% 0.32% NA
All Indica  2759 90.00% 4.90% 4.68% 0.51% NA
All Japonica  1512 99.90% 0.00% 0.00% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 66.70% 17.60% 15.46% 0.17% NA
Indica II  465 98.50% 0.00% 1.51% 0.00% NA
Indica III  913 98.50% 0.00% 0.44% 1.10% NA
Indica Intermediate  786 92.60% 3.70% 3.31% 0.38% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605699431 G -> A LOC_Os06g10910.1 upstream_gene_variant ; 2208.0bp to feature; MODIFIER silent_mutation Average:58.662; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0605699431 G -> A LOC_Os06g10900.1 downstream_gene_variant ; 4782.0bp to feature; MODIFIER silent_mutation Average:58.662; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0605699431 G -> A LOC_Os06g10900-LOC_Os06g10910 intergenic_region ; MODIFIER silent_mutation Average:58.662; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0605699431 G -> DEL N N silent_mutation Average:58.662; most accessible tissue: Minghui63 root, score: 78.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605699431 NA 6.80E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605699431 NA 1.89E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605699431 4.69E-06 4.68E-06 mr1171_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605699431 NA 3.38E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605699431 NA 3.69E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251