Variant ID: vg0605699431 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 5699431 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATTATTACGACCCATCAAATGAGGGGAGGGGAGAGGAGAGGGGAGGAGAGACGAGATAATTGGATGGGAAGTGAGAGGCAGCAAGGGGAGGGGGTGGAA[G/A]
TGATCAGGAGCGATGGGAGGGAGTCGCCATTCCGACGGGAAGTGAGGACATGCCCCATCAGAACGAGAGGGGGAAGCACGATCAAGGGACACATGCCAAA
TTTGGCATGTGTCCCTTGATCGTGCTTCCCCCTCTCGTTCTGATGGGGCATGTCCTCACTTCCCGTCGGAATGGCGACTCCCTCCCATCGCTCCTGATCA[C/T]
TTCCACCCCCTCCCCTTGCTGCCTCTCACTTCCCATCCAATTATCTCGTCTCTCCTCCCCTCTCCTCTCCCCTCCCCTCATTTGATGGGTCGTAATAATC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.00% | 2.90% | 2.79% | 0.32% | NA |
All Indica | 2759 | 90.00% | 4.90% | 4.68% | 0.51% | NA |
All Japonica | 1512 | 99.90% | 0.00% | 0.00% | 0.07% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 66.70% | 17.60% | 15.46% | 0.17% | NA |
Indica II | 465 | 98.50% | 0.00% | 1.51% | 0.00% | NA |
Indica III | 913 | 98.50% | 0.00% | 0.44% | 1.10% | NA |
Indica Intermediate | 786 | 92.60% | 3.70% | 3.31% | 0.38% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 1.10% | 3.33% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0605699431 | G -> A | LOC_Os06g10910.1 | upstream_gene_variant ; 2208.0bp to feature; MODIFIER | silent_mutation | Average:58.662; most accessible tissue: Minghui63 root, score: 78.091 | N | N | N | N |
vg0605699431 | G -> A | LOC_Os06g10900.1 | downstream_gene_variant ; 4782.0bp to feature; MODIFIER | silent_mutation | Average:58.662; most accessible tissue: Minghui63 root, score: 78.091 | N | N | N | N |
vg0605699431 | G -> A | LOC_Os06g10900-LOC_Os06g10910 | intergenic_region ; MODIFIER | silent_mutation | Average:58.662; most accessible tissue: Minghui63 root, score: 78.091 | N | N | N | N |
vg0605699431 | G -> DEL | N | N | silent_mutation | Average:58.662; most accessible tissue: Minghui63 root, score: 78.091 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0605699431 | NA | 6.80E-07 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0605699431 | NA | 1.89E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0605699431 | 4.69E-06 | 4.68E-06 | mr1171_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0605699431 | NA | 3.38E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0605699431 | NA | 3.69E-06 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |