Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605682284:

Variant ID: vg0605682284 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 5682284
Reference Allele: GAlternative Allele: GTAGCACTTATA,A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAAAAAAATAATTTCATAACTCACCTGAAAACCGCGAGACGAATCTTTTGAGCCTAATTAATTCGGCATTAGCACATGCAGGTTACTGTAGCACTTAT[G/GTAGCACTTATA,A]
ACTAATCATGAACTAATTAGACTCAAAAGATTCGTCTTGCGATTTCCCTATAACTGTGTAATTAGTTTTTTTATTTATCTATATTTAATGTTTCATACAT

Reverse complement sequence

ATGTATGAAACATTAAATATAGATAAATAAAAAAACTAATTACACAGTTATAGGGAAATCGCAAGACGAATCTTTTGAGTCTAATTAGTTCATGATTAGT[C/TATAAGTGCTAC,T]
ATAAGTGCTACAGTAACCTGCATGTGCTAATGCCGAATTAATTAGGCTCAAAAGATTCGTCTCGCGGTTTTCAGGTGAGTTATGAAATTATTTTTTTCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.10% 30.40% 1.50% 8.55% GTAGCACTTATA: 28.40%
All Indica  2759 36.00% 3.30% 1.96% 11.20% GTAGCACTTATA: 47.52%
All Japonica  1512 20.90% 77.50% 0.33% 0.40% GTAGCACTTATA: 0.86%
Aus  269 41.30% 55.00% 0.00% 3.35% GTAGCACTTATA: 0.37%
Indica I  595 12.80% 2.20% 3.87% 31.76% GTAGCACTTATA: 49.41%
Indica II  465 60.90% 1.90% 1.29% 0.43% GTAGCACTTATA: 35.48%
Indica III  913 40.30% 2.50% 0.44% 3.29% GTAGCACTTATA: 53.45%
Indica Intermediate  786 34.00% 5.90% 2.67% 11.20% GTAGCACTTATA: 46.31%
Temperate Japonica  767 0.80% 98.30% 0.13% 0.00% GTAGCACTTATA: 0.78%
Tropical Japonica  504 47.80% 51.00% 0.60% 0.00% GTAGCACTTATA: 0.60%
Japonica Intermediate  241 28.60% 66.80% 0.41% 2.49% GTAGCACTTATA: 1.66%
VI/Aromatic  96 11.50% 5.20% 6.25% 75.00% GTAGCACTTATA: 2.08%
Intermediate  90 42.20% 25.60% 6.67% 8.89% GTAGCACTTATA: 16.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605682284 G -> A LOC_Os06g10880.2 downstream_gene_variant ; 158.0bp to feature; MODIFIER silent_mutation Average:63.78; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0605682284 G -> A LOC_Os06g10880.1 downstream_gene_variant ; 158.0bp to feature; MODIFIER silent_mutation Average:63.78; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0605682284 G -> A LOC_Os06g10880.3 downstream_gene_variant ; 158.0bp to feature; MODIFIER silent_mutation Average:63.78; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0605682284 G -> A LOC_Os06g10880-LOC_Os06g10890 intergenic_region ; MODIFIER silent_mutation Average:63.78; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0605682284 G -> DEL N N silent_mutation Average:63.78; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0605682284 G -> GTAGCACTTATA LOC_Os06g10880.2 downstream_gene_variant ; 159.0bp to feature; MODIFIER silent_mutation Average:63.78; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0605682284 G -> GTAGCACTTATA LOC_Os06g10880.1 downstream_gene_variant ; 159.0bp to feature; MODIFIER silent_mutation Average:63.78; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0605682284 G -> GTAGCACTTATA LOC_Os06g10880.3 downstream_gene_variant ; 159.0bp to feature; MODIFIER silent_mutation Average:63.78; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0605682284 G -> GTAGCACTTATA LOC_Os06g10880-LOC_Os06g10890 intergenic_region ; MODIFIER silent_mutation Average:63.78; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0605682284 G A -0.01 -0.02 -0.01 -0.04 -0.02 -0.02
vg0605682284 G GTAGC* -0.2 -0.21 -0.12 -0.18 -0.18 -0.23

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605682284 6.20E-06 NA mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605682284 5.11E-06 NA mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605682284 1.27E-06 NA mr1201_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251