\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605617450:

Variant ID: vg0605617450 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5617450
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGGATAATGATAGCCTAAAAGTAGCTCACCTTTGCTGAGTTTTTTTTTAGAGAGAAAGGGATTAGCCACTCTTTAAATTAGCAGGAGAAGATAGAATG[A/C]
ATGGTAGGTCAAGAAATCCCCAAAACAGCTCATCTTAAATAGCTCAAGCTGTAATTCACTTAATTGATAGAAAAAAAAAGTTAACTTTAGATCCTTCAAC

Reverse complement sequence

GTTGAAGGATCTAAAGTTAACTTTTTTTTTCTATCAATTAAGTGAATTACAGCTTGAGCTATTTAAGATGAGCTGTTTTGGGGATTTCTTGACCTACCAT[T/G]
CATTCTATCTTCTCCTGCTAATTTAAAGAGTGGCTAATCCCTTTCTCTCTAAAAAAAAACTCAGCAAAGGTGAGCTACTTTTAGGCTATCATTATCCCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 38.30% 0.11% 0.00% NA
All Indica  2759 84.30% 15.60% 0.11% 0.00% NA
All Japonica  1512 22.60% 77.30% 0.07% 0.00% NA
Aus  269 34.90% 65.10% 0.00% 0.00% NA
Indica I  595 64.40% 35.60% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 93.40% 6.50% 0.11% 0.00% NA
Indica Intermediate  786 80.50% 19.20% 0.25% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 52.20% 47.60% 0.20% 0.00% NA
Japonica Intermediate  241 27.00% 73.00% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 6.20% 1.04% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605617450 A -> C LOC_Os06g10760.1 upstream_gene_variant ; 1655.0bp to feature; MODIFIER silent_mutation Average:59.802; most accessible tissue: Callus, score: 88.127 N N N N
vg0605617450 A -> C LOC_Os06g10770.1 upstream_gene_variant ; 4476.0bp to feature; MODIFIER silent_mutation Average:59.802; most accessible tissue: Callus, score: 88.127 N N N N
vg0605617450 A -> C LOC_Os06g10750.1 downstream_gene_variant ; 297.0bp to feature; MODIFIER silent_mutation Average:59.802; most accessible tissue: Callus, score: 88.127 N N N N
vg0605617450 A -> C LOC_Os06g10750-LOC_Os06g10760 intergenic_region ; MODIFIER silent_mutation Average:59.802; most accessible tissue: Callus, score: 88.127 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605617450 NA 5.47E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605617450 1.84E-08 NA mr1201 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605617450 1.05E-06 NA mr1219 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605617450 NA 8.52E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605617450 5.65E-06 NA mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605617450 1.66E-06 NA mr1274_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605617450 NA 4.65E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251