Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605613282:

Variant ID: vg0605613282 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5613282
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


TGAATCTAAATTCATTAGCATCATTATGAATGTGGGAAATGCTAGAATAATCTAGATTCATTAGTATCAATATGAATATGGGAAATGCTAGAATGATTTA[C/T]
ATTGTGAAACGGAGAAAGTATATTTATAATTGACGAAAACATTGTATATGTCTCGTCGTCGATGGATAGGTTTCAGTAGGAATTTCTACTGAAACCTATC

Reverse complement sequence

GATAGGTTTCAGTAGAAATTCCTACTGAAACCTATCCATCGACGACGAGACATATACAATGTTTTCGTCAATTATAAATATACTTTCTCCGTTTCACAAT[G/A]
TAAATCATTCTAGCATTTCCCATATTCATATTGATACTAATGAATCTAGATTATTCTAGCATTTCCCACATTCATAATGATGCTAATGAATTTAGATTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 7.40% 0.00% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 80.80% 19.20% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.70% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 53.20% 46.80% 0.00% 0.00% NA
Japonica Intermediate  241 79.30% 20.70% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605613282 C -> T LOC_Os06g10750.1 upstream_gene_variant ; 717.0bp to feature; MODIFIER silent_mutation Average:60.869; most accessible tissue: Callus, score: 85.848 N N N N
vg0605613282 C -> T LOC_Os06g10740.1 downstream_gene_variant ; 1845.0bp to feature; MODIFIER silent_mutation Average:60.869; most accessible tissue: Callus, score: 85.848 N N N N
vg0605613282 C -> T LOC_Os06g10740-LOC_Os06g10750 intergenic_region ; MODIFIER silent_mutation Average:60.869; most accessible tissue: Callus, score: 85.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605613282 NA 7.80E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605613282 NA 1.32E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605613282 NA 6.34E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605613282 NA 6.97E-09 mr1923_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605613282 NA 9.92E-06 mr1923_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251