\
| Variant ID: vg0605613282 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5613282 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )
TGAATCTAAATTCATTAGCATCATTATGAATGTGGGAAATGCTAGAATAATCTAGATTCATTAGTATCAATATGAATATGGGAAATGCTAGAATGATTTA[C/T]
ATTGTGAAACGGAGAAAGTATATTTATAATTGACGAAAACATTGTATATGTCTCGTCGTCGATGGATAGGTTTCAGTAGGAATTTCTACTGAAACCTATC
GATAGGTTTCAGTAGAAATTCCTACTGAAACCTATCCATCGACGACGAGACATATACAATGTTTTCGTCAATTATAAATATACTTTCTCCGTTTCACAAT[G/A]
TAAATCATTCTAGCATTTCCCATATTCATATTGATACTAATGAATCTAGATTATTCTAGCATTTCCCACATTCATAATGATGCTAATGAATTTAGATTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 80.80% | 19.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 53.20% | 46.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.30% | 20.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605613282 | C -> T | LOC_Os06g10750.1 | upstream_gene_variant ; 717.0bp to feature; MODIFIER | silent_mutation | Average:60.869; most accessible tissue: Callus, score: 85.848 | N | N | N | N |
| vg0605613282 | C -> T | LOC_Os06g10740.1 | downstream_gene_variant ; 1845.0bp to feature; MODIFIER | silent_mutation | Average:60.869; most accessible tissue: Callus, score: 85.848 | N | N | N | N |
| vg0605613282 | C -> T | LOC_Os06g10740-LOC_Os06g10750 | intergenic_region ; MODIFIER | silent_mutation | Average:60.869; most accessible tissue: Callus, score: 85.848 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605613282 | NA | 7.80E-06 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613282 | NA | 1.32E-07 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613282 | NA | 6.34E-06 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613282 | NA | 6.97E-09 | mr1923_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613282 | NA | 9.92E-06 | mr1923_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |