\
| Variant ID: vg0605613230 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5613230 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGTTTCACAACGTAAATCATTCTAGCATTTTTCATATTCATATTGATGCTAATGAATCTAAATTCATTAGCATCATTATGAATGTGGGAAATGCTAGAAT[A/G]
ATCTAGATTCATTAGTATCAATATGAATATGGGAAATGCTAGAATGATTTACATTGTGAAACGGAGAAAGTATATTTATAATTGACGAAAACATTGTATA
TATACAATGTTTTCGTCAATTATAAATATACTTTCTCCGTTTCACAATGTAAATCATTCTAGCATTTCCCATATTCATATTGATACTAATGAATCTAGAT[T/C]
ATTCTAGCATTTCCCACATTCATAATGATGCTAATGAATTTAGATTCATTAGCATCAATATGAATATGAAAAATGCTAGAATGATTTACGTTGTGAAACG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 4.70% | 0.97% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 89.60% | 7.50% | 2.91% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 83.20% | 11.50% | 5.35% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 9.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605613230 | A -> G | LOC_Os06g10750.1 | upstream_gene_variant ; 769.0bp to feature; MODIFIER | silent_mutation | Average:63.72; most accessible tissue: Callus, score: 85.848 | N | N | N | N |
| vg0605613230 | A -> G | LOC_Os06g10740.1 | downstream_gene_variant ; 1793.0bp to feature; MODIFIER | silent_mutation | Average:63.72; most accessible tissue: Callus, score: 85.848 | N | N | N | N |
| vg0605613230 | A -> G | LOC_Os06g10740-LOC_Os06g10750 | intergenic_region ; MODIFIER | silent_mutation | Average:63.72; most accessible tissue: Callus, score: 85.848 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605613230 | 5.36E-09 | NA | mr1210 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 7.90E-07 | 3.26E-09 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 1.13E-06 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | NA | 3.99E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 1.31E-06 | 1.51E-12 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 9.34E-06 | 8.22E-10 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 8.73E-09 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 1.43E-06 | 9.13E-09 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | NA | 7.59E-07 | mr1127_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 6.63E-10 | NA | mr1305_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 1.32E-07 | 4.60E-10 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 3.14E-06 | NA | mr1409_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 5.18E-07 | 2.73E-08 | mr1409_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | NA | 4.16E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 6.48E-07 | 3.57E-14 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 4.90E-06 | 5.53E-10 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 2.92E-06 | NA | mr1765_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | NA | 8.69E-07 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605613230 | 7.17E-06 | NA | mr1980_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |