\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605507888:

Variant ID: vg0605507888 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5507888
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAGACCAACATTCAGATATTAGGACAAGTAGATGGAGCACAATTTATTAATAGAATCTACTTCCATACCTTCAAGATGGATAATTTCTATAGCATAGA[C/T]
ATGTAATTAATTATATGATAGTATGCTAGTCGTTAGCAATATTAGTTAGGAGACAATCAACATTATACACAGTGATTGTAGAATCAACCTTTTGGTAGAA

Reverse complement sequence

TTCTACCAAAAGGTTGATTCTACAATCACTGTGTATAATGTTGATTGTCTCCTAACTAATATTGCTAACGACTAGCATACTATCATATAATTAATTACAT[G/A]
TCTATGCTATAGAAATTATCCATCTTGAAGGTATGGAAGTAGATTCTATTAATAAATTGTGCTCCATCTACTTGTCCTAATATCTGAATGTTGGTCTTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 36.70% 4.25% 0.00% NA
All Indica  2759 88.30% 8.60% 3.08% 0.00% NA
All Japonica  1512 15.40% 77.50% 7.08% 0.00% NA
Aus  269 2.60% 96.30% 1.12% 0.00% NA
Indica I  595 90.10% 3.50% 6.39% 0.00% NA
Indica II  465 96.10% 1.10% 2.80% 0.00% NA
Indica III  913 86.70% 12.90% 0.33% 0.00% NA
Indica Intermediate  786 84.20% 11.80% 3.94% 0.00% NA
Temperate Japonica  767 16.70% 71.10% 12.26% 0.00% NA
Tropical Japonica  504 14.70% 83.90% 1.39% 0.00% NA
Japonica Intermediate  241 12.90% 84.60% 2.49% 0.00% NA
VI/Aromatic  96 67.70% 31.20% 1.04% 0.00% NA
Intermediate  90 54.40% 40.00% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605507888 C -> T LOC_Os06g10600-LOC_Os06g10610 intergenic_region ; MODIFIER silent_mutation Average:19.044; most accessible tissue: Callus, score: 41.252 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605507888 NA 2.73E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888 NA 2.89E-20 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888 NA 3.79E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888 NA 2.30E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888 NA 8.47E-09 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888 NA 1.07E-34 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888 NA 6.33E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888 NA 5.19E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888 NA 3.05E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888 NA 1.46E-13 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888 NA 9.26E-47 mr1745_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888 NA 3.64E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251