Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605507888:

Variant ID: vg0605507888 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5507888
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

CTAAGACCAACATTCAGATATTAGGACAAGTAGATGGAGCACAATTTATTAATAGAATCTACTTCCATACCTTCAAGATGGATAATTTCTATAGCATAGA[C/T]
ATGTAATTAATTATATGATAGTATGCTAGTCGTTAGCAATATTAGTTAGGAGACAATCAACATTATACACAGTGATTGTAGAATCAACCTTTTGGTAGAA

Reverse complement sequence

TTCTACCAAAAGGTTGATTCTACAATCACTGTGTATAATGTTGATTGTCTCCTAACTAATATTGCTAACGACTAGCATACTATCATATAATTAATTACAT[G/A]
TCTATGCTATAGAAATTATCCATCTTGAAGGTATGGAAGTAGATTCTATTAATAAATTGTGCTCCATCTACTTGTCCTAATATCTGAATGTTGGTCTTAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.10%	36.70%	4.25%	0.00%	NA
All Indica	2759	88.30%	8.60%	3.08%	0.00%	NA
All Japonica	1512	15.40%	77.50%	7.08%	0.00%	NA
Aus	269	2.60%	96.30%	1.12%	0.00%	NA
Indica I	595	90.10%	3.50%	6.39%	0.00%	NA
Indica II	465	96.10%	1.10%	2.80%	0.00%	NA
Indica III	913	86.70%	12.90%	0.33%	0.00%	NA
Indica Intermediate	786	84.20%	11.80%	3.94%	0.00%	NA
Temperate Japonica	767	16.70%	71.10%	12.26%	0.00%	NA
Tropical Japonica	504	14.70%	83.90%	1.39%	0.00%	NA
Japonica Intermediate	241	12.90%	84.60%	2.49%	0.00%	NA
VI/Aromatic	96	67.70%	31.20%	1.04%	0.00%	NA
Intermediate	90	54.40%	40.00%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605507888	C -> T	LOC_Os06g10600-LOC_Os06g10610	intergenic_region ; MODIFIER	silent_mutation	Average:19.044; most accessible tissue: Callus, score: 41.252	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605507888	NA	2.73E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888	NA	2.89E-20	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888	NA	3.79E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888	NA	2.30E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888	NA	8.47E-09	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888	NA	1.07E-34	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888	NA	6.33E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888	NA	5.19E-12	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888	NA	3.05E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888	NA	1.46E-13	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888	NA	9.26E-47	mr1745_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605507888	NA	3.64E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251