\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605448742:

Variant ID: vg0605448742 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5448742
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.10, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAATTTAACATCAAATATATTTTTGATATAAAGTTTATTTTGTATTGAAAATGTTACTATATTTTGCTACAAATATGATCAAATTCTAAGAAGCTTGA[T/C]
TAAGAAAAAAAGTTAAACGACTTATAATATGATACAGAGGGAGTATATGATTGACATTTGGCATGATTATCTTATTGTTCAAAAATATCTAAGTCAGAAA

Reverse complement sequence

TTTCTGACTTAGATATTTTTGAACAATAAGATAATCATGCCAAATGTCAATCATATACTCCCTCTGTATCATATTATAAGTCGTTTAACTTTTTTTCTTA[A/G]
TCAAGCTTCTTAGAATTTGATCATATTTGTAGCAAAATATAGTAACATTTTCAATACAAAATAAACTTTATATCAAAAATATATTTGATGTTAAATTTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 8.00% 0.02% 0.00% NA
All Indica  2759 87.70% 12.20% 0.04% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 91.80% 8.20% 0.00% 0.00% NA
Indica I  595 78.20% 21.80% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 85.80% 14.20% 0.00% 0.00% NA
Indica Intermediate  786 90.10% 9.80% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605448742 T -> C LOC_Os06g10560.1 upstream_gene_variant ; 362.0bp to feature; MODIFIER silent_mutation Average:43.665; most accessible tissue: Callus, score: 80.875 N N N N
vg0605448742 T -> C LOC_Os06g10550-LOC_Os06g10560 intergenic_region ; MODIFIER silent_mutation Average:43.665; most accessible tissue: Callus, score: 80.875 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605448742 2.59E-14 6.63E-28 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605448742 2.49E-14 2.34E-28 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605448742 2.59E-09 9.51E-18 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605448742 1.34E-10 2.19E-21 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605448742 4.58E-11 2.94E-22 mr1274 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605448742 4.70E-14 5.65E-23 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605448742 7.96E-13 8.40E-23 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605448742 9.13E-14 1.32E-22 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605448742 9.51E-08 4.13E-14 mr1219_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605448742 4.29E-09 4.85E-16 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605448742 1.95E-09 1.60E-20 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605448742 1.03E-10 8.47E-21 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251