\
| Variant ID: vg0605448742 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5448742 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.10, others allele: 0.00, population size: 109. )
TTAAATTTAACATCAAATATATTTTTGATATAAAGTTTATTTTGTATTGAAAATGTTACTATATTTTGCTACAAATATGATCAAATTCTAAGAAGCTTGA[T/C]
TAAGAAAAAAAGTTAAACGACTTATAATATGATACAGAGGGAGTATATGATTGACATTTGGCATGATTATCTTATTGTTCAAAAATATCTAAGTCAGAAA
TTTCTGACTTAGATATTTTTGAACAATAAGATAATCATGCCAAATGTCAATCATATACTCCCTCTGTATCATATTATAAGTCGTTTAACTTTTTTTCTTA[A/G]
TCAAGCTTCTTAGAATTTGATCATATTTGTAGCAAAATATAGTAACATTTTCAATACAAAATAAACTTTATATCAAAAATATATTTGATGTTAAATTTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.90% | 8.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 87.70% | 12.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 78.20% | 21.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.80% | 14.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.10% | 9.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605448742 | T -> C | LOC_Os06g10560.1 | upstream_gene_variant ; 362.0bp to feature; MODIFIER | silent_mutation | Average:43.665; most accessible tissue: Callus, score: 80.875 | N | N | N | N |
| vg0605448742 | T -> C | LOC_Os06g10550-LOC_Os06g10560 | intergenic_region ; MODIFIER | silent_mutation | Average:43.665; most accessible tissue: Callus, score: 80.875 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605448742 | 2.59E-14 | 6.63E-28 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605448742 | 2.49E-14 | 2.34E-28 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605448742 | 2.59E-09 | 9.51E-18 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605448742 | 1.34E-10 | 2.19E-21 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605448742 | 4.58E-11 | 2.94E-22 | mr1274 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605448742 | 4.70E-14 | 5.65E-23 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605448742 | 7.96E-13 | 8.40E-23 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605448742 | 9.13E-14 | 1.32E-22 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605448742 | 9.51E-08 | 4.13E-14 | mr1219_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605448742 | 4.29E-09 | 4.85E-16 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605448742 | 1.95E-09 | 1.60E-20 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605448742 | 1.03E-10 | 8.47E-21 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |