\
| Variant ID: vg0605440935 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5440935 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, T: 0.22, others allele: 0.00, population size: 213. )
CTTTGGGTTGATGTCCAAATCGAAGTTCATAAGAAGTTTTTCCAAGTTTTGATCTCAAGAAAACCCGATTTGAAATATAACAAGCAGTGTTAATCGCCTC[T/A]
GCCCAAAATTTTCTTGGAGTTTTATATTCATCCAACATCGTTCTAGCCATCTCAACCAAAACATGGTTTTTCCTTTCAACAACACCGTTTTGTTGAGGAA
TTCCTCAACAAAACGGTGTTGTTGAAAGGAAAAACCATGTTTTGGTTGAGATGGCTAGAACGATGTTGGATGAATATAAAACTCCAAGAAAATTTTGGGC[A/T]
GAGGCGATTAACACTGCTTGTTATATTTCAAATCGGGTTTTCTTGAGATCAAAACTTGGAAAAACTTCTTATGAACTTCGATTTGGACATCAACCCAAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.80% | 8.10% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 87.60% | 12.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.80% | 14.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.90% | 9.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605440935 | T -> A | LOC_Os06g10550.1 | synonymous_variant ; p.Ala312Ala; LOW | synonymous_codon | Average:21.101; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605440935 | 2.28E-08 | 6.09E-19 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605440935 | 6.27E-09 | 5.66E-18 | mr1201 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605440935 | 5.91E-06 | 2.01E-12 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605440935 | 3.47E-06 | 4.56E-14 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605440935 | 1.52E-06 | 6.46E-15 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605440935 | 9.33E-08 | 3.07E-15 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605440935 | 1.76E-07 | 2.39E-15 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605440935 | 2.61E-08 | 1.61E-14 | mr1201_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605440935 | NA | 1.61E-09 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605440935 | NA | 1.09E-10 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605440935 | NA | 1.86E-13 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605440935 | NA | 3.32E-13 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |