\
| Variant ID: vg0605437555 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5437555 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.06, others allele: 0.00, population size: 218. )
CGAACCTGCGATTCACCTGTAAATCCAATCATCTCCAAAACCACTTCGTGAACAAAACCAATAATCTCTAATACCCAATTATTCATCACAGAATAATAAT[A/C]
AAAAACACCTTTGATTTTATAATCTCCCCCTTGATGAACACATTGGCAAACCAATAAAAAATGTTTTGGTGTTTGGAAAAATAAAAACAAAAGTGATAAA
TTTATCACTTTTGTTTTTATTTTTCCAAACACCAAAACATTTTTTATTGGTTTGCCAATGTGTTCATCAAGGGGGAGATTATAAAATCAAAGGTGTTTTT[T/G]
ATTATTATTCTGTGATGAATAATTGGGTATTAGAGATTATTGGTTTTGTTCACGAAGTGGTTTTGGAGATGATTGGATTTACAGGTGAATCGCAGGTTCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.80% | 8.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 87.60% | 12.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.80% | 14.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.80% | 10.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605437555 | A -> C | LOC_Os06g10540.1 | upstream_gene_variant ; 3773.0bp to feature; MODIFIER | silent_mutation | Average:37.649; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0605437555 | A -> C | LOC_Os06g10550.1 | downstream_gene_variant ; 1137.0bp to feature; MODIFIER | silent_mutation | Average:37.649; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0605437555 | A -> C | LOC_Os06g10540-LOC_Os06g10550 | intergenic_region ; MODIFIER | silent_mutation | Average:37.649; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605437555 | 4.69E-12 | 2.79E-26 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605437555 | 1.26E-13 | 1.13E-27 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605437555 | 2.87E-09 | 6.05E-18 | mr1219 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605437555 | 8.95E-11 | 6.83E-22 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605437555 | 2.54E-11 | 1.61E-22 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605437555 | 2.04E-14 | 2.30E-23 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605437555 | 1.61E-10 | 3.25E-21 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605437555 | 3.41E-13 | 4.06E-22 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605437555 | 1.18E-06 | 1.87E-13 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605437555 | 3.28E-09 | 3.34E-16 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605437555 | 7.49E-09 | 1.90E-20 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605437555 | 1.15E-10 | 4.53E-21 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |