\
| Variant ID: vg0605415219 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5415219 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, T: 0.45, others allele: 0.00, population size: 99. )
AACACTTTTTAATTTTTAAGTAGTAGAGATTGAGATAGAGATACAGATAGAGATAGAGATAGAGAAACGGAAAACTTTTTTTGAAACTTTTTTTTTGGAA[C/T]
CGGACAGAAAAAATTTTACGTTTGTTTTTTACCGCATAGATGGAATCGGATTCAATTTGTTTTTTTACCACGCCGTGTCACATATAATAGGATTCGATTT
AAATCGAATCCTATTATATGTGACACGGCGTGGTAAAAAAACAAATTGAATCCGATTCCATCTATGCGGTAAAAAACAAACGTAAAATTTTTTCTGTCCG[G/A]
TTCCAAAAAAAAAGTTTCAAAAAAAGTTTTCCGTTTCTCTATCTCTATCTCTATCTGTATCTCTATCTCAATCTCTACTACTTAAAAATTAAAAAGTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.30% | 24.60% | 1.74% | 1.31% | NA |
| All Indica | 2759 | 78.50% | 16.80% | 2.50% | 2.25% | NA |
| All Japonica | 1512 | 64.00% | 35.40% | 0.60% | 0.00% | NA |
| Aus | 269 | 81.80% | 18.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 52.30% | 32.90% | 7.73% | 7.06% | NA |
| Indica II | 465 | 96.30% | 1.70% | 1.08% | 0.86% | NA |
| Indica III | 913 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.20% | 14.50% | 2.29% | 2.04% | NA |
| Temperate Japonica | 767 | 97.00% | 2.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 18.50% | 80.40% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.90% | 45.20% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 85.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 37.80% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605415219 | C -> T | LOC_Os06g10510-LOC_Os06g10520 | intergenic_region ; MODIFIER | silent_mutation | Average:32.172; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0605415219 | C -> DEL | N | N | silent_mutation | Average:32.172; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605415219 | 4.30E-10 | 1.22E-23 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605415219 | 1.67E-17 | 7.66E-49 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605415219 | 2.95E-08 | 3.20E-18 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605415219 | 6.08E-16 | 4.65E-41 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605415219 | 5.91E-09 | 1.19E-18 | mr1274 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605415219 | 1.66E-17 | 1.30E-41 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605415219 | NA | 6.82E-06 | mr1544 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605415219 | 6.97E-12 | 6.77E-23 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605415219 | 3.40E-19 | 3.10E-42 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605415219 | 8.34E-08 | 1.09E-16 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605415219 | 1.33E-15 | 3.81E-35 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605415219 | 6.68E-08 | 1.39E-16 | mr1274_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605415219 | 2.12E-17 | 1.82E-40 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |