\
| Variant ID: vg0605381468 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5381468 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )
AAATACAGGACAAGCATACAACACCCCTAAGGAATGGGTCTTCTAAACGACGCCTCCAAGGAGGAAACGACGCCAATAGCACCGCCGCCGCCCGTCCTAG[G/T]
ACAGGACATGGTTTTCACCTGAAGAACTCACTGAGAGAGGAAAGAAAATACAGCAACGCCCCAAGGGAAAAACGGCGCCCGCAGGCATCGCCGTTGCCAG
CTGGCAACGGCGATGCCTGCGGGCGCCGTTTTTCCCTTGGGGCGTTGCTGTATTTTCTTTCCTCTCTCAGTGAGTTCTTCAGGTGAAAACCATGTCCTGT[C/A]
CTAGGACGGGCGGCGGCGGTGCTATTGGCGTCGTTTCCTCCTTGGAGGCGTCGTTTAGAAGACCCATTCCTTAGGGGTGTTGTATGCTTGTCCTGTATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.20% | 1.70% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 94.80% | 5.00% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 90.00% | 9.50% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605381468 | G -> T | LOC_Os06g10460.1 | upstream_gene_variant ; 4932.0bp to feature; MODIFIER | silent_mutation | Average:64.336; most accessible tissue: Minghui63 panicle, score: 84.005 | N | N | N | N |
| vg0605381468 | G -> T | LOC_Os06g10450.1 | downstream_gene_variant ; 4686.0bp to feature; MODIFIER | silent_mutation | Average:64.336; most accessible tissue: Minghui63 panicle, score: 84.005 | N | N | N | N |
| vg0605381468 | G -> T | LOC_Os06g10450-LOC_Os06g10460 | intergenic_region ; MODIFIER | silent_mutation | Average:64.336; most accessible tissue: Minghui63 panicle, score: 84.005 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605381468 | NA | 2.60E-06 | mr1072 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605381468 | NA | 6.45E-06 | mr1161 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605381468 | NA | 2.43E-06 | mr1183 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605381468 | 7.76E-07 | 5.24E-07 | mr1318 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605381468 | NA | 6.65E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605381468 | NA | 7.27E-06 | mr1763 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605381468 | NA | 3.05E-06 | mr1775 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |