RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0605381468:

Variant ID: vg0605381468 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5381468
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

AAATACAGGACAAGCATACAACACCCCTAAGGAATGGGTCTTCTAAACGACGCCTCCAAGGAGGAAACGACGCCAATAGCACCGCCGCCGCCCGTCCTAG[G/T]
ACAGGACATGGTTTTCACCTGAAGAACTCACTGAGAGAGGAAAGAAAATACAGCAACGCCCCAAGGGAAAAACGGCGCCCGCAGGCATCGCCGTTGCCAG

Reverse complement sequence

CTGGCAACGGCGATGCCTGCGGGCGCCGTTTTTCCCTTGGGGCGTTGCTGTATTTTCTTTCCTCTCTCAGTGAGTTCTTCAGGTGAAAACCATGTCCTGT[C/A]
CTAGGACGGGCGGCGGCGGTGCTATTGGCGTCGTTTCCTCCTTGGAGGCGTCGTTTAGAAGACCCATTCCTTAGGGGTGTTGTATGCTTGTCCTGTATTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.20%	1.70%	0.11%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.04%	0.00%	NA
All Japonica	1512	94.80%	5.00%	0.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	90.00%	9.50%	0.52%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605381468	G -> T	LOC_Os06g10460.1	upstream_gene_variant ; 4932.0bp to feature; MODIFIER	silent_mutation	Average:64.336; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0605381468	G -> T	LOC_Os06g10450.1	downstream_gene_variant ; 4686.0bp to feature; MODIFIER	silent_mutation	Average:64.336; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0605381468	G -> T	LOC_Os06g10450-LOC_Os06g10460	intergenic_region ; MODIFIER	silent_mutation	Average:64.336; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605381468	NA	2.60E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605381468	NA	6.45E-06	mr1161	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605381468	NA	2.43E-06	mr1183	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605381468	7.76E-07	5.24E-07	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605381468	NA	6.65E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605381468	NA	7.27E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605381468	NA	3.05E-06	mr1775	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 7 of 7 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0605381468:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact