\
| Variant ID: vg0605351193 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5351193 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACAAGTTACTAAAAAAACTAGAATATTAGGGAAGGACCTAATATCAAATAATTAGGAGGGGTGAGGCTTTGAACCCAGGTCGTCTAGCCCACCACCTTGT[G/A]
GAGCTAGCCGGAAGACTCCTAGGCATTTCTCATCTTCCACAAGTTACTCATATCAGCTAAATGAAGTTTTAATACAAACACATGCTAAACATTGTTGTTT
AAACAACAATGTTTAGCATGTGTTTGTATTAAAACTTCATTTAGCTGATATGAGTAACTTGTGGAAGATGAGAAATGCCTAGGAGTCTTCCGGCTAGCTC[C/T]
ACAAGGTGGTGGGCTAGACGACCTGGGTTCAAAGCCTCACCCCTCCTAATTATTTGATATTAGGTCCTTCCCTAATATTCTAGTTTTTTTAGTAACTTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.20% | 1.80% | 0.49% | 12.55% | NA |
| All Indica | 2759 | 79.60% | 0.00% | 0.25% | 20.08% | NA |
| All Japonica | 1512 | 94.10% | 5.00% | 0.79% | 0.07% | NA |
| Aus | 269 | 88.10% | 0.00% | 0.00% | 11.90% | NA |
| Indica I | 595 | 66.40% | 0.00% | 0.17% | 33.45% | NA |
| Indica II | 465 | 99.40% | 0.20% | 0.00% | 0.43% | NA |
| Indica III | 913 | 74.80% | 0.00% | 0.33% | 24.86% | NA |
| Indica Intermediate | 786 | 83.60% | 0.00% | 0.38% | 16.03% | NA |
| Temperate Japonica | 767 | 89.40% | 9.60% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.60% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 6.70% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605351193 | G -> A | LOC_Os06g10410.1 | upstream_gene_variant ; 2514.0bp to feature; MODIFIER | silent_mutation | Average:28.104; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0605351193 | G -> A | LOC_Os06g10410-LOC_Os06g10420 | intergenic_region ; MODIFIER | silent_mutation | Average:28.104; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0605351193 | G -> DEL | N | N | silent_mutation | Average:28.104; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605351193 | 5.38E-06 | 5.38E-06 | mr1060 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605351193 | NA | 1.24E-06 | mr1072 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605351193 | 8.41E-06 | 8.41E-06 | mr1283 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605351193 | 6.06E-06 | 6.06E-06 | mr1288 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605351193 | 2.27E-07 | 2.56E-07 | mr1318 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605351193 | NA | 4.47E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605351193 | NA | 7.49E-06 | mr1482 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605351193 | 3.62E-06 | NA | mr1707 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605351193 | NA | 1.77E-06 | mr1763 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605351193 | NA | 2.93E-06 | mr1775 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605351193 | NA | 4.87E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |