\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605343435:

Variant ID: vg0605343435 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5343435
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGTGCCATGTTAGCCAAAACCACTGTTTAAACCACCTTGGGACTTTTATTTGTACTTGTTTGGAGAATTGAGGGACGTATCATATTTGATATTTGGTAT[C/T]
GTGGTTCGATGAATTCCAGATTCGACGGCTACTTGAGGAACCAAAAGTGAACTTATTCCGTGTCTGGGTTATATGTAATTGCTCCAAACGGTGGCCTGTT

Reverse complement sequence

AACAGGCCACCGTTTGGAGCAATTACATATAACCCAGACACGGAATAAGTTCACTTTTGGTTCCTCAAGTAGCCGTCGAATCTGGAATTCATCGAACCAC[G/A]
ATACCAAATATCAAATATGATACGTCCCTCAATTCTCCAAACAAGTACAAATAAAAGTCCCAAGGTGGTTTAAACAGTGGTTTTGGCTAACATGGCACCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 13.30% 0.80% 0.00% NA
All Indica  2759 98.30% 1.60% 0.14% 0.00% NA
All Japonica  1512 72.10% 25.90% 1.98% 0.00% NA
Aus  269 34.20% 65.10% 0.74% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.40% 0.25% 0.00% NA
Temperate Japonica  767 53.60% 42.60% 3.78% 0.00% NA
Tropical Japonica  504 98.00% 1.80% 0.20% 0.00% NA
Japonica Intermediate  241 76.80% 23.20% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 6.20% 2.08% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605343435 C -> T LOC_Os06g10390.1 upstream_gene_variant ; 2807.0bp to feature; MODIFIER silent_mutation Average:90.142; most accessible tissue: Callus, score: 95.374 N N N N
vg0605343435 C -> T LOC_Os06g10400.1 upstream_gene_variant ; 616.0bp to feature; MODIFIER silent_mutation Average:90.142; most accessible tissue: Callus, score: 95.374 N N N N
vg0605343435 C -> T LOC_Os06g10410.1 downstream_gene_variant ; 1942.0bp to feature; MODIFIER silent_mutation Average:90.142; most accessible tissue: Callus, score: 95.374 N N N N
vg0605343435 C -> T LOC_Os06g10400-LOC_Os06g10410 intergenic_region ; MODIFIER silent_mutation Average:90.142; most accessible tissue: Callus, score: 95.374 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0605343435 C T 0.04 0.05 0.03 0.02 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605343435 NA 1.56E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 7.22E-07 NA mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 NA 2.76E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 NA 1.94E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 NA 5.74E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 NA 9.38E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 1.29E-06 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 NA 2.53E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 NA 1.93E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 NA 1.41E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 NA 2.80E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 NA 1.44E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 1.05E-06 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 NA 1.83E-11 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 1.74E-06 NA mr1219_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605343435 NA 4.56E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251