Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605335883:

Variant ID: vg0605335883 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5335883
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

CGACGAAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTTGAAATCGTAGCTAGCTAGGACATATAATGGATTGTAATTAATA[C/T]
ATTACTACATATGTTTCTATATGCATGTGTACACATTTTCTATAATGTAAATATATTTTGGTCATATGTTATGCAAATGCATATGTGTATATATGTGTGT

Reverse complement sequence

ACACACATATATACACATATGCATTTGCATAACATATGACCAAAATATATTTACATTATAGAAAATGTGTACACATGCATATAGAAACATATGTAGTAAT[G/A]
TATTAATTACAATCCATTATATGTCCTAGCTAGCTACGATTTCAACGTAGTAGTAGTCGCTAGCTCAGAAGCTAAGGACCTATGAATTGTGTTTTCGTCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.00%	1.10%	8.91%	0.00%	NA
All Indica	2759	84.20%	1.70%	14.10%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.13%	0.00%	NA
Aus	269	90.00%	0.40%	9.67%	0.00%	NA
Indica I	595	71.40%	2.00%	26.55%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	81.30%	2.60%	16.10%	0.00%	NA
Indica Intermediate	786	88.20%	1.30%	10.56%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.20%	0.40%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	2.20%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605335883	C -> T	LOC_Os06g10380.1	downstream_gene_variant ; 34.0bp to feature; MODIFIER	silent_mutation	Average:22.039; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0605335883	C -> T	LOC_Os06g10390.1	downstream_gene_variant ; 1116.0bp to feature; MODIFIER	silent_mutation	Average:22.039; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0605335883	C -> T	LOC_Os06g10380-LOC_Os06g10390	intergenic_region ; MODIFIER	silent_mutation	Average:22.039; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605335883	2.63E-12	1.16E-33	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605335883	1.28E-14	2.56E-38	mr1219	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605335883	6.05E-15	7.50E-32	mr1274	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605335883	3.35E-12	7.58E-27	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605335883	6.36E-13	9.23E-29	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605335883	1.11E-12	1.16E-28	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251