\
| Variant ID: vg0605332135 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5332135 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGCCCCGCCTGCCAGTACCCCCTCCCTCTCTCTCTCCTTGAGTCACTAACCCGCGGGTCCTGCGTGTCGGCGCCGCCCCCCTGCTGACGTCAGCCCTGGG[G/A]
CAATATTGCGCAATAAATACATTAAGGCTTTTCTTTAATAGTAAAAACACAGAGAATCTTCTAAAAATCATAACTAATTCATCCGAGCTCCGATTAAGTC
GACTTAATCGGAGCTCGGATGAATTAGTTATGATTTTTAGAAGATTCTCTGTGTTTTTACTATTAAAGAAAAGCCTTAATGTATTTATTGCGCAATATTG[C/T]
CCCAGGGCTGACGTCAGCAGGGGGGCGGCGCCGACACGCAGGACCCGCGGGTTAGTGACTCAAGGAGAGAGAGAGGGAGGGGGTACTGGCAGGCGGGGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.70% | 12.20% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 80.30% | 19.50% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.20% | 32.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 75.80% | 24.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 84.10% | 15.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605332135 | G -> A | LOC_Os06g10380.1 | upstream_gene_variant ; 758.0bp to feature; MODIFIER | silent_mutation | Average:60.406; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0605332135 | G -> A | LOC_Os06g10370.1 | downstream_gene_variant ; 1404.0bp to feature; MODIFIER | silent_mutation | Average:60.406; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0605332135 | G -> A | LOC_Os06g10390.1 | downstream_gene_variant ; 4864.0bp to feature; MODIFIER | silent_mutation | Average:60.406; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0605332135 | G -> A | LOC_Os06g10370-LOC_Os06g10380 | intergenic_region ; MODIFIER | silent_mutation | Average:60.406; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605332135 | 5.69E-10 | 1.08E-28 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605332135 | 4.89E-06 | 2.02E-28 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605332135 | 3.10E-12 | 7.10E-26 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605332135 | 3.03E-07 | 2.71E-30 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605332135 | 6.23E-10 | 1.73E-29 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605332135 | 1.38E-07 | 3.77E-26 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605332135 | 1.37E-15 | 9.93E-33 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605332135 | 4.17E-14 | 8.36E-33 | mr1201_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605332135 | 5.62E-16 | 4.78E-29 | mr1219_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605332135 | 2.14E-15 | 3.53E-35 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605332135 | 2.07E-13 | 4.42E-33 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605332135 | 3.01E-13 | 3.50E-33 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |