\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605332135:

Variant ID: vg0605332135 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5332135
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCCCCGCCTGCCAGTACCCCCTCCCTCTCTCTCTCCTTGAGTCACTAACCCGCGGGTCCTGCGTGTCGGCGCCGCCCCCCTGCTGACGTCAGCCCTGGG[G/A]
CAATATTGCGCAATAAATACATTAAGGCTTTTCTTTAATAGTAAAAACACAGAGAATCTTCTAAAAATCATAACTAATTCATCCGAGCTCCGATTAAGTC

Reverse complement sequence

GACTTAATCGGAGCTCGGATGAATTAGTTATGATTTTTAGAAGATTCTCTGTGTTTTTACTATTAAAGAAAAGCCTTAATGTATTTATTGCGCAATATTG[C/T]
CCCAGGGCTGACGTCAGCAGGGGGGCGGCGCCGACACGCAGGACCCGCGGGTTAGTGACTCAAGGAGAGAGAGAGGGAGGGGGTACTGGCAGGCGGGGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 12.20% 0.08% 0.00% NA
All Indica  2759 80.30% 19.50% 0.14% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 88.10% 11.90% 0.00% 0.00% NA
Indica I  595 67.20% 32.40% 0.34% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 75.80% 24.10% 0.11% 0.00% NA
Indica Intermediate  786 84.10% 15.80% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605332135 G -> A LOC_Os06g10380.1 upstream_gene_variant ; 758.0bp to feature; MODIFIER silent_mutation Average:60.406; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg0605332135 G -> A LOC_Os06g10370.1 downstream_gene_variant ; 1404.0bp to feature; MODIFIER silent_mutation Average:60.406; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg0605332135 G -> A LOC_Os06g10390.1 downstream_gene_variant ; 4864.0bp to feature; MODIFIER silent_mutation Average:60.406; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg0605332135 G -> A LOC_Os06g10370-LOC_Os06g10380 intergenic_region ; MODIFIER silent_mutation Average:60.406; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605332135 5.69E-10 1.08E-28 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605332135 4.89E-06 2.02E-28 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605332135 3.10E-12 7.10E-26 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605332135 3.03E-07 2.71E-30 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605332135 6.23E-10 1.73E-29 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605332135 1.38E-07 3.77E-26 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605332135 1.37E-15 9.93E-33 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605332135 4.17E-14 8.36E-33 mr1201_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605332135 5.62E-16 4.78E-29 mr1219_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605332135 2.14E-15 3.53E-35 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605332135 2.07E-13 4.42E-33 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605332135 3.01E-13 3.50E-33 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251