\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605322557:

Variant ID: vg0605322557 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5322557
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCCTCTAATGTTTTTTTGTCATATTACATTTGCAGCTATGTTTTGCACACTTTTTTGTCTCTAAAATTTAGTTGTAAGTTGATGAAGGAGAAAATTTGT[A/G]
TGGGGAAGAAAGAATATATAGAAATTTAGTTGATTTGCTAAAGAAGTTTTTATAAAATAGTTGAGAAGGAAAACTATAGTGAAAGTTAATCTTGAATACT

Reverse complement sequence

AGTATTCAAGATTAACTTTCACTATAGTTTTCCTTCTCAACTATTTTATAAAAACTTCTTTAGCAAATCAACTAAATTTCTATATATTCTTTCTTCCCCA[T/C]
ACAAATTTTCTCCTTCATCAACTTACAACTAAATTTTAGAGACAAAAAAGTGTGCAAAACATAGCTGCAAATGTAATATGACAAAAAAACATTAGAGGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 12.70% 0.15% 0.00% NA
All Indica  2759 79.80% 20.10% 0.07% 0.00% NA
All Japonica  1512 99.50% 0.30% 0.13% 0.00% NA
Aus  269 88.10% 11.90% 0.00% 0.00% NA
Indica I  595 66.40% 33.30% 0.34% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 75.10% 24.90% 0.00% 0.00% NA
Indica Intermediate  786 83.80% 16.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 0.80% 0.40% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 88.90% 7.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605322557 A -> G LOC_Os06g10355.1 upstream_gene_variant ; 3546.0bp to feature; MODIFIER silent_mutation Average:10.28; most accessible tissue: Minghui63 flower, score: 17.517 N N N N
vg0605322557 A -> G LOC_Os06g10360.1 upstream_gene_variant ; 573.0bp to feature; MODIFIER silent_mutation Average:10.28; most accessible tissue: Minghui63 flower, score: 17.517 N N N N
vg0605322557 A -> G LOC_Os06g10355-LOC_Os06g10360 intergenic_region ; MODIFIER silent_mutation Average:10.28; most accessible tissue: Minghui63 flower, score: 17.517 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605322557 3.04E-13 1.12E-30 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557 8.71E-12 8.92E-32 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557 5.73E-13 2.16E-24 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557 2.03E-09 2.78E-27 mr1219 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557 3.85E-14 2.87E-29 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557 2.15E-13 4.31E-29 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557 5.81E-10 8.52E-25 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557 7.58E-12 3.38E-27 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557 6.07E-10 1.06E-20 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557 4.63E-10 2.83E-24 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557 9.14E-09 9.30E-25 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557 3.03E-10 3.46E-27 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251