Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605322557:

Variant ID: vg0605322557 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5322557
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCCTCTAATGTTTTTTTGTCATATTACATTTGCAGCTATGTTTTGCACACTTTTTTGTCTCTAAAATTTAGTTGTAAGTTGATGAAGGAGAAAATTTGT[A/G]
TGGGGAAGAAAGAATATATAGAAATTTAGTTGATTTGCTAAAGAAGTTTTTATAAAATAGTTGAGAAGGAAAACTATAGTGAAAGTTAATCTTGAATACT

Reverse complement sequence

AGTATTCAAGATTAACTTTCACTATAGTTTTCCTTCTCAACTATTTTATAAAAACTTCTTTAGCAAATCAACTAAATTTCTATATATTCTTTCTTCCCCA[T/C]
ACAAATTTTCTCCTTCATCAACTTACAACTAAATTTTAGAGACAAAAAAGTGTGCAAAACATAGCTGCAAATGTAATATGACAAAAAAACATTAGAGGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.10%	12.70%	0.15%	0.00%	NA
All Indica	2759	79.80%	20.10%	0.07%	0.00%	NA
All Japonica	1512	99.50%	0.30%	0.13%	0.00%	NA
Aus	269	88.10%	11.90%	0.00%	0.00%	NA
Indica I	595	66.40%	33.30%	0.34%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	75.10%	24.90%	0.00%	0.00%	NA
Indica Intermediate	786	83.80%	16.20%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	0.80%	0.40%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	88.90%	7.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605322557	A -> G	LOC_Os06g10355.1	upstream_gene_variant ; 3546.0bp to feature; MODIFIER	silent_mutation	Average:10.28; most accessible tissue: Minghui63 flower, score: 17.517	N	N	N	N
vg0605322557	A -> G	LOC_Os06g10360.1	upstream_gene_variant ; 573.0bp to feature; MODIFIER	silent_mutation	Average:10.28; most accessible tissue: Minghui63 flower, score: 17.517	N	N	N	N
vg0605322557	A -> G	LOC_Os06g10355-LOC_Os06g10360	intergenic_region ; MODIFIER	silent_mutation	Average:10.28; most accessible tissue: Minghui63 flower, score: 17.517	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605322557	3.04E-13	1.12E-30	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557	8.71E-12	8.92E-32	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557	5.73E-13	2.16E-24	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557	2.03E-09	2.78E-27	mr1219	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557	3.85E-14	2.87E-29	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557	2.15E-13	4.31E-29	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557	5.81E-10	8.52E-25	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557	7.58E-12	3.38E-27	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557	6.07E-10	1.06E-20	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557	4.63E-10	2.83E-24	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557	9.14E-09	9.30E-25	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322557	3.03E-10	3.46E-27	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251