\
| Variant ID: vg0605322089 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5322089 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 109. )
AAACCATCTTTCGTCGGTCGGCCGAATTCCACGATAGTCCCGGATGCAATAAAAACCGGGGCTAAAGATGATCTTTAGTCTTGGTTAAAAAGGGTAACGG[G/A]
CATATTTGATCTTTAGTCCCGGTTGGTAACACCAACCAGGACTAAAGATGATCTTTAGTCCCGGTTCAAATGCTGTCAGGGCCTGTCAGGCCCCCCGGAT
ATCCGGGGGGCCTGACAGGCCCTGACAGCATTTGAACCGGGACTAAAGATCATCTTTAGTCCTGGTTGGTGTTACCAACCGGGACTAAAGATCAAATATG[C/T]
CCGTTACCCTTTTTAACCAAGACTAAAGATCATCTTTAGCCCCGGTTTTTATTGCATCCGGGACTATCGTGGAATTCGGCCGACCGACGAAAGATGGTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 8.10% | 1.35% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 1.60% | 0.62% | 0.00% | NA |
| All Japonica | 1512 | 78.30% | 19.00% | 2.65% | 0.00% | NA |
| Aus | 269 | 84.80% | 13.80% | 1.49% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.00% | 1.34% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 3.80% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 96.60% | 1.70% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 54.20% | 41.90% | 3.97% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.50% | 26.60% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 14.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605322089 | G -> A | LOC_Os06g10355.1 | upstream_gene_variant ; 3078.0bp to feature; MODIFIER | silent_mutation | Average:32.193; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0605322089 | G -> A | LOC_Os06g10360.1 | upstream_gene_variant ; 1041.0bp to feature; MODIFIER | silent_mutation | Average:32.193; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0605322089 | G -> A | LOC_Os06g10355-LOC_Os06g10360 | intergenic_region ; MODIFIER | silent_mutation | Average:32.193; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605322089 | 3.01E-08 | NA | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605322089 | 3.07E-07 | 7.45E-07 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605322089 | 1.33E-10 | 3.44E-08 | mr1274 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605322089 | 2.84E-08 | 6.78E-07 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605322089 | 1.49E-08 | 1.34E-08 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605322089 | 3.81E-10 | 7.62E-07 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605322089 | NA | 5.75E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605322089 | NA | 9.74E-06 | mr1923_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |