Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605321614:

Variant ID: vg0605321614 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5321614
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

CCATGTCTAGAGTCTAGTAAATATGTAGCCCCGTCACAGTTGAGAGAGGATCAGCAGAGGACGGATTAAGAAAATGACATGATCGATCACACGTAGAAAG[T/C]
TAGGTGGCAGCAGTACGTGGTGGAGGGAGGGAGATGAGGCGGCGTGGGAAATTAACGTCGGGGGTTTACCTGAAGCGCGCTAGCTCGCTCGTACCATGTG

Reverse complement sequence

CACATGGTACGAGCGAGCTAGCGCGCTTCAGGTAAACCCCCGACGTTAATTTCCCACGCCGCCTCATCTCCCTCCCTCCACCACGTACTGCTGCCACCTA[A/G]
CTTTCTACGTGTGATCGATCATGTCATTTTCTTAATCCGTCCTCTGCTGATCCTCTCTCAACTGTGACGGGGCTACATATTTACTAGACTCTAGACATGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.80%	25.30%	3.87%	0.00%	NA
All Indica	2759	90.90%	5.00%	4.02%	0.00%	NA
All Japonica	1512	35.90%	60.10%	3.97%	0.00%	NA
Aus	269	82.20%	16.70%	1.12%	0.00%	NA
Indica I	595	88.20%	2.40%	9.41%	0.00%	NA
Indica II	465	92.90%	2.40%	4.73%	0.00%	NA
Indica III	913	92.10%	7.60%	0.33%	0.00%	NA
Indica Intermediate	786	90.50%	5.70%	3.82%	0.00%	NA
Temperate Japonica	767	43.70%	50.60%	5.74%	0.00%	NA
Tropical Japonica	504	27.80%	69.80%	2.38%	0.00%	NA
Japonica Intermediate	241	28.20%	70.10%	1.66%	0.00%	NA
VI/Aromatic	96	16.70%	81.20%	2.08%	0.00%	NA
Intermediate	90	63.30%	28.90%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605321614	T -> C	LOC_Os06g10355.1	upstream_gene_variant ; 2603.0bp to feature; MODIFIER	silent_mutation	Average:62.888; most accessible tissue: Callus, score: 96.973	N	N	N	N
vg0605321614	T -> C	LOC_Os06g10360.1	upstream_gene_variant ; 1516.0bp to feature; MODIFIER	silent_mutation	Average:62.888; most accessible tissue: Callus, score: 96.973	N	N	N	N
vg0605321614	T -> C	LOC_Os06g10350.1	downstream_gene_variant ; 4739.0bp to feature; MODIFIER	silent_mutation	Average:62.888; most accessible tissue: Callus, score: 96.973	N	N	N	N
vg0605321614	T -> C	LOC_Os06g10355-LOC_Os06g10360	intergenic_region ; MODIFIER	silent_mutation	Average:62.888; most accessible tissue: Callus, score: 96.973	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605321614	1.59E-07	NA	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605321614	1.91E-07	7.71E-06	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605321614	5.70E-08	1.25E-06	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605321614	1.56E-07	NA	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605321614	7.78E-06	2.96E-08	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605321614	8.87E-06	NA	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605321614	NA	4.65E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605321614	7.28E-07	NA	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605321614	6.04E-09	3.66E-07	mr1219_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605321614	3.03E-08	NA	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605321614	8.62E-06	2.09E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605321614	3.29E-06	NA	mr1879_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605321614	NA	5.24E-06	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251