\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605316987:

Variant ID: vg0605316987 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5316987
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGCTGTGATTTTTTTTTCTTCCTCACCAAAACAAATCTTGTAATAGATTTAACGATTCAAAATTACGTGAAACTTATATGCAAGTTACACTGTAGTTA[C/T]
ATGCAAGTTACAATGTAATTATATATAAGTTACAGTGTAATTACACTACGATTGTACTATAATTACATCTGTCAAATTTTTAGGAGAAAATTTGTCGACA

Reverse complement sequence

TGTCGACAAATTTTCTCCTAAAAATTTGACAGATGTAATTATAGTACAATCGTAGTGTAATTACACTGTAACTTATATATAATTACATTGTAACTTGCAT[G/A]
TAACTACAGTGTAACTTGCATATAAGTTTCACGTAATTTTGAATCGTTAAATCTATTACAAGATTTGTTTTGGTGAGGAAGAAAAAAAAATCACAGCACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.00% 12.90% 0.06% 0.00% NA
All Indica  2759 79.60% 20.30% 0.04% 0.00% NA
All Japonica  1512 99.50% 0.30% 0.13% 0.00% NA
Aus  269 88.10% 11.90% 0.00% 0.00% NA
Indica I  595 66.10% 33.90% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 74.90% 25.10% 0.00% 0.00% NA
Indica Intermediate  786 83.60% 16.30% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 0.80% 0.40% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605316987 C -> T LOC_Os06g10350.1 downstream_gene_variant ; 112.0bp to feature; MODIFIER silent_mutation Average:27.017; most accessible tissue: Callus, score: 60.731 N N N N
vg0605316987 C -> T LOC_Os06g10355.1 downstream_gene_variant ; 491.0bp to feature; MODIFIER silent_mutation Average:27.017; most accessible tissue: Callus, score: 60.731 N N N N
vg0605316987 C -> T LOC_Os06g10350-LOC_Os06g10355 intergenic_region ; MODIFIER silent_mutation Average:27.017; most accessible tissue: Callus, score: 60.731 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605316987 1.09E-11 1.46E-28 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 1.71E-09 5.67E-28 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 2.00E-08 2.94E-18 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 2.48E-06 7.21E-21 mr1219 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 3.67E-10 1.03E-24 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 6.66E-10 8.98E-25 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 NA 1.35E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 NA 5.57E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 1.17E-10 7.54E-25 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 5.15E-10 2.88E-24 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 3.75E-08 2.25E-17 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 2.45E-07 2.56E-19 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 2.53E-08 2.13E-23 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987 2.81E-09 3.93E-24 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251