Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605316987:

Variant ID: vg0605316987 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5316987
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGCTGTGATTTTTTTTTCTTCCTCACCAAAACAAATCTTGTAATAGATTTAACGATTCAAAATTACGTGAAACTTATATGCAAGTTACACTGTAGTTA[C/T]
ATGCAAGTTACAATGTAATTATATATAAGTTACAGTGTAATTACACTACGATTGTACTATAATTACATCTGTCAAATTTTTAGGAGAAAATTTGTCGACA

Reverse complement sequence

TGTCGACAAATTTTCTCCTAAAAATTTGACAGATGTAATTATAGTACAATCGTAGTGTAATTACACTGTAACTTATATATAATTACATTGTAACTTGCAT[G/A]
TAACTACAGTGTAACTTGCATATAAGTTTCACGTAATTTTGAATCGTTAAATCTATTACAAGATTTGTTTTGGTGAGGAAGAAAAAAAAATCACAGCACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.00%	12.90%	0.06%	0.00%	NA
All Indica	2759	79.60%	20.30%	0.04%	0.00%	NA
All Japonica	1512	99.50%	0.30%	0.13%	0.00%	NA
Aus	269	88.10%	11.90%	0.00%	0.00%	NA
Indica I	595	66.10%	33.90%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	74.90%	25.10%	0.00%	0.00%	NA
Indica Intermediate	786	83.60%	16.30%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	0.80%	0.40%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605316987	C -> T	LOC_Os06g10350.1	downstream_gene_variant ; 112.0bp to feature; MODIFIER	silent_mutation	Average:27.017; most accessible tissue: Callus, score: 60.731	N	N	N	N
vg0605316987	C -> T	LOC_Os06g10355.1	downstream_gene_variant ; 491.0bp to feature; MODIFIER	silent_mutation	Average:27.017; most accessible tissue: Callus, score: 60.731	N	N	N	N
vg0605316987	C -> T	LOC_Os06g10350-LOC_Os06g10355	intergenic_region ; MODIFIER	silent_mutation	Average:27.017; most accessible tissue: Callus, score: 60.731	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605316987	1.09E-11	1.46E-28	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	1.71E-09	5.67E-28	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	2.00E-08	2.94E-18	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	2.48E-06	7.21E-21	mr1219	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	3.67E-10	1.03E-24	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	6.66E-10	8.98E-25	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	NA	1.35E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	NA	5.57E-06	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	1.17E-10	7.54E-25	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	5.15E-10	2.88E-24	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	3.75E-08	2.25E-17	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	2.45E-07	2.56E-19	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	2.53E-08	2.13E-23	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605316987	2.81E-09	3.93E-24	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251