Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605314203:

Variant ID: vg0605314203 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5314203
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTGGTTTTCGTGTTCCGAGAAAAAATTGTTTCCGTATTTGTGTCCGATCATATTCGATTCTTATTCGTATTCGAGATAGTCCGTATTTGTTTCCGTATT[C/T]
GAGCTATCCGTATTCGTTTCCGTATCCGGCAAAAAATATAAAAACGAATATATATAAAAACGAATATGATATGAGCATTATCCGTCCGTATCCGCTCCGT

Reverse complement sequence

ACGGAGCGGATACGGACGGATAATGCTCATATCATATTCGTTTTTATATATATTCGTTTTTATATTTTTTGCCGGATACGGAAACGAATACGGATAGCTC[G/A]
AATACGGAAACAAATACGGACTATCTCGAATACGAATAAGAATCGAATATGATCGGACACAAATACGGAAACAATTTTTTCTCGGAACACGAAAACCAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.50%	4.40%	0.13%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.04%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	34.20%	64.30%	1.49%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.40%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605314203	C -> T	LOC_Os06g10350.1	upstream_gene_variant ; 975.0bp to feature; MODIFIER	silent_mutation	Average:20.874; most accessible tissue: Callus, score: 28.343	N	N	N	N
vg0605314203	C -> T	LOC_Os06g10340.1	downstream_gene_variant ; 3601.0bp to feature; MODIFIER	silent_mutation	Average:20.874; most accessible tissue: Callus, score: 28.343	N	N	N	N
vg0605314203	C -> T	LOC_Os06g10355.1	downstream_gene_variant ; 3275.0bp to feature; MODIFIER	silent_mutation	Average:20.874; most accessible tissue: Callus, score: 28.343	N	N	N	N
vg0605314203	C -> T	LOC_Os06g10340-LOC_Os06g10350	intergenic_region ; MODIFIER	silent_mutation	Average:20.874; most accessible tissue: Callus, score: 28.343	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605314203	NA	3.44E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203	4.05E-06	NA	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203	NA	6.78E-08	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203	NA	1.81E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203	NA	3.54E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203	2.10E-07	NA	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203	2.63E-07	NA	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203	7.40E-06	NA	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203	1.70E-07	5.09E-23	mr1587_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203	NA	2.99E-26	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251