\
| Variant ID: vg0605314203 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5314203 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTGGTTTTCGTGTTCCGAGAAAAAATTGTTTCCGTATTTGTGTCCGATCATATTCGATTCTTATTCGTATTCGAGATAGTCCGTATTTGTTTCCGTATT[C/T]
GAGCTATCCGTATTCGTTTCCGTATCCGGCAAAAAATATAAAAACGAATATATATAAAAACGAATATGATATGAGCATTATCCGTCCGTATCCGCTCCGT
ACGGAGCGGATACGGACGGATAATGCTCATATCATATTCGTTTTTATATATATTCGTTTTTATATTTTTTGCCGGATACGGAAACGAATACGGATAGCTC[G/A]
AATACGGAAACAAATACGGACTATCTCGAATACGAATAAGAATCGAATATGATCGGACACAAATACGGAAACAATTTTTTCTCGGAACACGAAAACCAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 4.40% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 34.20% | 64.30% | 1.49% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605314203 | C -> T | LOC_Os06g10350.1 | upstream_gene_variant ; 975.0bp to feature; MODIFIER | silent_mutation | Average:20.874; most accessible tissue: Callus, score: 28.343 | N | N | N | N |
| vg0605314203 | C -> T | LOC_Os06g10340.1 | downstream_gene_variant ; 3601.0bp to feature; MODIFIER | silent_mutation | Average:20.874; most accessible tissue: Callus, score: 28.343 | N | N | N | N |
| vg0605314203 | C -> T | LOC_Os06g10355.1 | downstream_gene_variant ; 3275.0bp to feature; MODIFIER | silent_mutation | Average:20.874; most accessible tissue: Callus, score: 28.343 | N | N | N | N |
| vg0605314203 | C -> T | LOC_Os06g10340-LOC_Os06g10350 | intergenic_region ; MODIFIER | silent_mutation | Average:20.874; most accessible tissue: Callus, score: 28.343 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605314203 | NA | 3.44E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605314203 | 4.05E-06 | NA | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605314203 | NA | 6.78E-08 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605314203 | NA | 1.81E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605314203 | NA | 3.54E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605314203 | 2.10E-07 | NA | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605314203 | 2.63E-07 | NA | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605314203 | 7.40E-06 | NA | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605314203 | 1.70E-07 | 5.09E-23 | mr1587_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605314203 | NA | 2.99E-26 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |