\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605314203:

Variant ID: vg0605314203 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5314203
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGGTTTTCGTGTTCCGAGAAAAAATTGTTTCCGTATTTGTGTCCGATCATATTCGATTCTTATTCGTATTCGAGATAGTCCGTATTTGTTTCCGTATT[C/T]
GAGCTATCCGTATTCGTTTCCGTATCCGGCAAAAAATATAAAAACGAATATATATAAAAACGAATATGATATGAGCATTATCCGTCCGTATCCGCTCCGT

Reverse complement sequence

ACGGAGCGGATACGGACGGATAATGCTCATATCATATTCGTTTTTATATATATTCGTTTTTATATTTTTTGCCGGATACGGAAACGAATACGGATAGCTC[G/A]
AATACGGAAACAAATACGGACTATCTCGAATACGAATAAGAATCGAATATGATCGGACACAAATACGGAAACAATTTTTTCTCGGAACACGAAAACCAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 4.40% 0.13% 0.00% NA
All Indica  2759 99.10% 0.90% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 34.20% 64.30% 1.49% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.40% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605314203 C -> T LOC_Os06g10350.1 upstream_gene_variant ; 975.0bp to feature; MODIFIER silent_mutation Average:20.874; most accessible tissue: Callus, score: 28.343 N N N N
vg0605314203 C -> T LOC_Os06g10340.1 downstream_gene_variant ; 3601.0bp to feature; MODIFIER silent_mutation Average:20.874; most accessible tissue: Callus, score: 28.343 N N N N
vg0605314203 C -> T LOC_Os06g10355.1 downstream_gene_variant ; 3275.0bp to feature; MODIFIER silent_mutation Average:20.874; most accessible tissue: Callus, score: 28.343 N N N N
vg0605314203 C -> T LOC_Os06g10340-LOC_Os06g10350 intergenic_region ; MODIFIER silent_mutation Average:20.874; most accessible tissue: Callus, score: 28.343 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605314203 NA 3.44E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203 4.05E-06 NA mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203 NA 6.78E-08 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203 NA 1.81E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203 NA 3.54E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203 2.10E-07 NA mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203 2.63E-07 NA mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203 7.40E-06 NA mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203 1.70E-07 5.09E-23 mr1587_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605314203 NA 2.99E-26 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251