\
| Variant ID: vg0605274340 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5274340 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.06, others allele: 0.00, population size: 195. )
TAACTATTACAGATATTTGAGTTACTTCAAAATCGCATCGTTTATACTCCCTCCGTACCAAAATAAGTGTAGTTTTTACACTGTTTATGTCTAACGTTTG[G/A]
CTATTCGTCTTATTTAAAAAAATATGTTTAGTATTTTTGTTGTTATTAGATGATAAAACATGAATAGTACTTTATGTGTGACTATTTTTTTTAATTTTTT
AAAAAATTAAAAAAAATAGTCACACATAAAGTACTATTCATGTTTTATCATCTAATAACAACAAAAATACTAAACATATTTTTTTAAATAAGACGAATAG[C/T]
CAAACGTTAGACATAAACAGTGTAAAAACTACACTTATTTTGGTACGGAGGGAGTATAAACGATGCGATTTTGAAGTAACTCAAATATCTGTAATAGTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.40% | 21.40% | 1.18% | 0.00% | NA |
| All Indica | 2759 | 77.30% | 21.90% | 0.83% | 0.00% | NA |
| All Japonica | 1512 | 83.50% | 14.90% | 1.59% | 0.00% | NA |
| Aus | 269 | 71.70% | 27.10% | 1.12% | 0.00% | NA |
| Indica I | 595 | 64.20% | 33.80% | 2.02% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 72.90% | 26.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 79.60% | 19.30% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 95.80% | 2.10% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 72.20% | 26.80% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.60% | 31.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 90.60% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 24.40% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605274340 | G -> A | LOC_Os06g10280.1 | downstream_gene_variant ; 2250.0bp to feature; MODIFIER | silent_mutation | Average:58.101; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0605274340 | G -> A | LOC_Os06g10260-LOC_Os06g10280 | intergenic_region ; MODIFIER | silent_mutation | Average:58.101; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605274340 | 6.57E-24 | 3.65E-44 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605274340 | 2.95E-24 | 5.03E-49 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605274340 | 3.03E-24 | 9.51E-38 | mr1219 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605274340 | 7.69E-24 | 2.09E-46 | mr1219 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605274340 | 1.49E-24 | 1.05E-36 | mr1274 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605274340 | 3.79E-26 | 3.06E-44 | mr1274 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605274340 | 2.92E-24 | 1.11E-41 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605274340 | 6.54E-23 | 1.79E-41 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605274340 | 8.48E-24 | 8.20E-39 | mr1219_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605274340 | 2.41E-22 | 3.09E-40 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605274340 | 1.56E-19 | 4.89E-34 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605274340 | 3.16E-21 | 1.60E-40 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |