| Variant ID: vg0605218848 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5218848 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 107. )
AAGTATATAAAAACCAAAATAGATATTATTCCATATATCTTTACTTGACCAAAATTACATAATATTAACAGTCTCCTTAATAAACTCAGGGCCGTCCCAT[G/A]
AAATTTGGAGGCCCCGTGTGAAATCTTCTAACTTAAGCGATAAAATAAACCGGTAAACTTACACTCCATGATATATTTTAGCAATATAAACTTAATAGAA
TTCTATTAAGTTTATATTGCTAAAATATATCATGGAGTGTAAGTTTACCGGTTTATTTTATCGCTTAAGTTAGAAGATTTCACACGGGGCCTCCAAATTT[C/T]
ATGGGACGGCCCTGAGTTTATTAAGGAGACTGTTAATATTATGTAATTTTGGTCAAGTAAAGATATATGGAATAATATCTATTTTGGTTTTTATATACTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.70% | 25.20% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 80.80% | 19.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 57.90% | 41.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.90% | 35.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.10% | 20.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.10% | 14.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 49.00% | 50.60% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 65.10% | 34.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.40% | 28.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605218848 | G -> A | LOC_Os06g10180.1 | upstream_gene_variant ; 4249.0bp to feature; MODIFIER | silent_mutation | Average:46.745; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0605218848 | G -> A | LOC_Os06g10190.1 | upstream_gene_variant ; 817.0bp to feature; MODIFIER | silent_mutation | Average:46.745; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0605218848 | G -> A | LOC_Os06g10200.2 | upstream_gene_variant ; 2571.0bp to feature; MODIFIER | silent_mutation | Average:46.745; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0605218848 | G -> A | LOC_Os06g10200.4 | upstream_gene_variant ; 2571.0bp to feature; MODIFIER | silent_mutation | Average:46.745; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0605218848 | G -> A | LOC_Os06g10200.1 | upstream_gene_variant ; 2571.0bp to feature; MODIFIER | silent_mutation | Average:46.745; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0605218848 | G -> A | LOC_Os06g10200.3 | upstream_gene_variant ; 2571.0bp to feature; MODIFIER | silent_mutation | Average:46.745; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0605218848 | G -> A | LOC_Os06g10190-LOC_Os06g10200 | intergenic_region ; MODIFIER | silent_mutation | Average:46.745; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605218848 | NA | 5.22E-09 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605218848 | 4.92E-14 | 2.13E-33 | mr1201 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605218848 | NA | 7.60E-07 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605218848 | 2.91E-11 | 2.47E-27 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605218848 | NA | 1.71E-07 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605218848 | 1.74E-14 | 2.31E-30 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605218848 | NA | 8.45E-07 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605218848 | 1.04E-13 | 6.13E-28 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605218848 | 6.31E-11 | 9.48E-24 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605218848 | NA | 1.61E-08 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605218848 | 7.35E-12 | 1.85E-27 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |