Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605181590:

Variant ID: vg0605181590 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5181590
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAAATGTTACTCCCTCCGTTTTATAATGTAAGTCATTCTAGCATTTCCCACATTCATATTGATGTTAATGAATCTAGATAGATATATATGTCTAGATT[T/C]
ATTAACATTAATATGAATGTGGGAAATGCTAAAATGACTTATATTATGAAACGGAGGGAGTAGCCTTTAGGAAAATGAGCATGTGCATTGCTAGCAGTTT

Reverse complement sequence

AAACTGCTAGCAATGCACATGCTCATTTTCCTAAAGGCTACTCCCTCCGTTTCATAATATAAGTCATTTTAGCATTTCCCACATTCATATTAATGTTAAT[A/G]
AATCTAGACATATATATCTATCTAGATTCATTAACATCAATATGAATGTGGGAAATGCTAGAATGACTTACATTATAAAACGGAGGGAGTAACATTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.80%	14.60%	0.53%	0.00%	NA
All Indica	2759	94.30%	5.70%	0.07%	0.00%	NA
All Japonica	1512	68.40%	30.20%	1.39%	0.00%	NA
Aus	269	77.30%	22.70%	0.00%	0.00%	NA
Indica I	595	97.50%	2.50%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	94.60%	5.40%	0.00%	0.00%	NA
Indica Intermediate	786	88.90%	10.80%	0.25%	0.00%	NA
Temperate Japonica	767	84.10%	13.70%	2.22%	0.00%	NA
Tropical Japonica	504	44.00%	55.80%	0.20%	0.00%	NA
Japonica Intermediate	241	69.30%	29.50%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	18.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605181590	T -> C	LOC_Os06g10130.1	downstream_gene_variant ; 842.0bp to feature; MODIFIER	silent_mutation	Average:34.753; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0605181590	T -> C	LOC_Os06g10140.1	downstream_gene_variant ; 4857.0bp to feature; MODIFIER	silent_mutation	Average:34.753; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0605181590	T -> C	LOC_Os06g10130-LOC_Os06g10140	intergenic_region ; MODIFIER	silent_mutation	Average:34.753; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605181590	5.27E-06	1.16E-10	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	NA	3.03E-14	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	2.17E-06	2.05E-10	mr1219	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	NA	1.94E-13	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	2.88E-07	1.55E-12	mr1274	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	2.20E-06	8.34E-16	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	NA	5.24E-09	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	9.33E-06	1.59E-09	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	NA	4.36E-11	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	NA	1.85E-08	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	NA	4.28E-10	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	4.93E-06	5.29E-10	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	NA	1.70E-13	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605181590	NA	1.88E-07	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251