\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605179267:

Variant ID: vg0605179267 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5179267
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, C: 0.08, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCACAACCAAAGTAAAAAGAGCCTGTATACTCTATATATATAAAAAAAAAACAGGTGTGCCTATATATATATATATGTGTAAAAAGAGCACATTCCAT[C/G]
TTCTAGGACTCTGCCTCTGTGTACTCTCAGGATTTGTTTTTTTTTTTTAACGAAGGGTGTACATCTGAGTAATAAGCTTATGTTCTACAGTAGAAAAAGA

Reverse complement sequence

TCTTTTTCTACTGTAGAACATAAGCTTATTACTCAGATGTACACCCTTCGTTAAAAAAAAAAAACAAATCCTGAGAGTACACAGAGGCAGAGTCCTAGAA[G/C]
ATGGAATGTGCTCTTTTTACACATATATATATATATAGGCACACCTGTTTTTTTTTTATATATATAGAGTATACAGGCTCTTTTTACTTTGGTTGTGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 37.20% 0.32% 0.08% NA
All Indica  2759 69.30% 30.60% 0.07% 0.00% NA
All Japonica  1512 45.60% 53.40% 0.79% 0.20% NA
Aus  269 75.10% 24.90% 0.00% 0.00% NA
Indica I  595 57.60% 42.40% 0.00% 0.00% NA
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 64.60% 35.30% 0.11% 0.00% NA
Indica Intermediate  786 69.50% 30.40% 0.13% 0.00% NA
Temperate Japonica  767 49.20% 49.80% 0.78% 0.26% NA
Tropical Japonica  504 38.90% 59.70% 1.19% 0.20% NA
Japonica Intermediate  241 48.10% 51.90% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605179267 C -> G LOC_Os06g10130.1 upstream_gene_variant ; 445.0bp to feature; MODIFIER silent_mutation Average:64.273; most accessible tissue: Minghui63 root, score: 87.964 N N N N
vg0605179267 C -> G LOC_Os06g10109-LOC_Os06g10130 intergenic_region ; MODIFIER silent_mutation Average:64.273; most accessible tissue: Minghui63 root, score: 87.964 N N N N
vg0605179267 C -> DEL N N silent_mutation Average:64.273; most accessible tissue: Minghui63 root, score: 87.964 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0605179267 C G -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605179267 9.84E-06 3.71E-11 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267 2.57E-10 8.51E-22 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267 NA 7.57E-10 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267 1.05E-09 5.17E-20 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267 NA 7.99E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267 NA 2.42E-12 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267 2.20E-10 7.07E-21 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267 3.33E-07 7.26E-11 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267 9.34E-11 7.35E-20 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267 1.60E-06 2.60E-09 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267 1.07E-10 2.56E-18 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267 1.79E-07 1.82E-12 mr1274_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267 2.42E-09 6.90E-20 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251