Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605179267:

Variant ID: vg0605179267 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5179267
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, C: 0.08, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

AGCCACAACCAAAGTAAAAAGAGCCTGTATACTCTATATATATAAAAAAAAAACAGGTGTGCCTATATATATATATATGTGTAAAAAGAGCACATTCCAT[C/G]
TTCTAGGACTCTGCCTCTGTGTACTCTCAGGATTTGTTTTTTTTTTTTAACGAAGGGTGTACATCTGAGTAATAAGCTTATGTTCTACAGTAGAAAAAGA

Reverse complement sequence

TCTTTTTCTACTGTAGAACATAAGCTTATTACTCAGATGTACACCCTTCGTTAAAAAAAAAAAACAAATCCTGAGAGTACACAGAGGCAGAGTCCTAGAA[G/C]
ATGGAATGTGCTCTTTTTACACATATATATATATATAGGCACACCTGTTTTTTTTTTATATATATAGAGTATACAGGCTCTTTTTACTTTGGTTGTGGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	37.20%	0.32%	0.08%	NA
All Indica	2759	69.30%	30.60%	0.07%	0.00%	NA
All Japonica	1512	45.60%	53.40%	0.79%	0.20%	NA
Aus	269	75.10%	24.90%	0.00%	0.00%	NA
Indica I	595	57.60%	42.40%	0.00%	0.00%	NA
Indica II	465	93.30%	6.70%	0.00%	0.00%	NA
Indica III	913	64.60%	35.30%	0.11%	0.00%	NA
Indica Intermediate	786	69.50%	30.40%	0.13%	0.00%	NA
Temperate Japonica	767	49.20%	49.80%	0.78%	0.26%	NA
Tropical Japonica	504	38.90%	59.70%	1.19%	0.20%	NA
Japonica Intermediate	241	48.10%	51.90%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	58.90%	38.90%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605179267	C -> G	LOC_Os06g10130.1	upstream_gene_variant ; 445.0bp to feature; MODIFIER	silent_mutation	Average:64.273; most accessible tissue: Minghui63 root, score: 87.964	N	N	N	N
vg0605179267	C -> G	LOC_Os06g10109-LOC_Os06g10130	intergenic_region ; MODIFIER	silent_mutation	Average:64.273; most accessible tissue: Minghui63 root, score: 87.964	N	N	N	N
vg0605179267	C -> DEL	N	N	silent_mutation	Average:64.273; most accessible tissue: Minghui63 root, score: 87.964	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0605179267	C	G	-0.01	-0.01	-0.01	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605179267	9.84E-06	3.71E-11	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267	2.57E-10	8.51E-22	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267	NA	7.57E-10	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267	1.05E-09	5.17E-20	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267	NA	7.99E-07	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267	NA	2.42E-12	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267	2.20E-10	7.07E-21	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267	3.33E-07	7.26E-11	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267	9.34E-11	7.35E-20	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267	1.60E-06	2.60E-09	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267	1.07E-10	2.56E-18	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267	1.79E-07	1.82E-12	mr1274_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605179267	2.42E-09	6.90E-20	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251