\
| Variant ID: vg0605170851 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5170851 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 99. )
ATGGAGCGGGTACTGCCAAAGTGAGGTTATTGAAAGGCTTTGTCGTGGCAAGTCTCATTCGTTGGGACGTAGGCTTATGTGTTGGGCAAGTCGCGGAGTA[T/C]
GGGTAAAGTGTACATCCACTACAGTATGAGTAAACCAATCTATTCGAATAGCCGTGCTCGCGGATATTGAGCACCGAGATATGTATTACACTTGGCTAGA
TCTAGCCAAGTGTAATACATATCTCGGTGCTCAATATCCGCGAGCACGGCTATTCGAATAGATTGGTTTACTCATACTGTAGTGGATGTACACTTTACCC[A/G]
TACTCCGCGACTTGCCCAACACATAAGCCTACGTCCCAACGAATGAGACTTGCCACGACAAAGCCTTTCAATAACCTCACTTTGGCAGTACCCGCTCCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.70% | 34.70% | 0.61% | 0.97% | NA |
| All Indica | 2759 | 70.90% | 26.80% | 0.62% | 1.67% | NA |
| All Japonica | 1512 | 46.20% | 53.40% | 0.40% | 0.00% | NA |
| Aus | 269 | 74.70% | 24.20% | 1.12% | 0.00% | NA |
| Indica I | 595 | 57.30% | 41.20% | 0.50% | 1.01% | NA |
| Indica II | 465 | 92.30% | 6.00% | 0.22% | 1.51% | NA |
| Indica III | 913 | 68.60% | 27.80% | 0.77% | 2.85% | NA |
| Indica Intermediate | 786 | 71.40% | 27.00% | 0.76% | 0.89% | NA |
| Temperate Japonica | 767 | 48.90% | 50.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 40.90% | 58.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 48.50% | 50.60% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 32.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605170851 | T -> C | LOC_Os06g10109-LOC_Os06g10130 | intergenic_region ; MODIFIER | silent_mutation | Average:52.25; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0605170851 | T -> DEL | N | N | silent_mutation | Average:52.25; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605170851 | NA | 7.11E-10 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605170851 | 4.07E-09 | 9.66E-19 | mr1201 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605170851 | NA | 1.48E-08 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605170851 | 5.61E-07 | 4.12E-16 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605170851 | NA | 1.50E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605170851 | NA | 7.00E-11 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605170851 | 3.11E-09 | 3.86E-19 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605170851 | 9.64E-07 | 8.96E-10 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605170851 | 1.16E-09 | 2.46E-17 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605170851 | NA | 4.82E-08 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605170851 | 7.81E-09 | 9.22E-16 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605170851 | 9.53E-06 | 9.85E-11 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605170851 | 1.11E-07 | 1.81E-17 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |