\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605162589:

Variant ID: vg0605162589 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5162589
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTTTAAGAGTAGAAATTTAACTTATTTGGACAGAGGGAATATTTATTTGAGTAAAACATGCAGCCCTGTTACTTTAAAAACGAATACTCCCTCCGTC[A/C]
AAAAAAAAAAGACAAACTCTAGGTTTCCGTGTCCAACTTTGACTATTCGTCTTATATGATTTTTTTTTATAATTCGTATTTTTATTGTTGTTAGATGATA

Reverse complement sequence

TATCATCTAACAACAATAAAAATACGAATTATAAAAAAAAATCATATAAGACGAATAGTCAAAGTTGGACACGGAAACCTAGAGTTTGTCTTTTTTTTTT[T/G]
GACGGAGGGAGTATTCGTTTTTAAAGTAACAGGGCTGCATGTTTTACTCAAATAAATATTCCCTCTGTCCAAATAAGTTAAATTTCTACTCTTAAAATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 10.00% 1.57% 0.85% NA
All Indica  2759 91.80% 6.20% 1.12% 0.87% NA
All Japonica  1512 91.10% 7.30% 1.52% 0.00% NA
Aus  269 22.70% 66.20% 6.32% 4.83% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 75.10% 23.70% 1.29% 0.00% NA
Indica III  913 95.60% 1.30% 1.31% 1.75% NA
Indica Intermediate  786 91.50% 5.90% 1.65% 1.02% NA
Temperate Japonica  767 96.90% 0.90% 2.22% 0.00% NA
Tropical Japonica  504 81.00% 18.30% 0.79% 0.00% NA
Japonica Intermediate  241 94.20% 5.00% 0.83% 0.00% NA
VI/Aromatic  96 94.80% 3.10% 2.08% 0.00% NA
Intermediate  90 83.30% 12.20% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605162589 A -> C LOC_Os06g10109.1 intron_variant ; MODIFIER silent_mutation Average:32.006; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0605162589 A -> DEL N N silent_mutation Average:32.006; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605162589 NA 4.02E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605162589 1.34E-07 3.88E-16 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605162589 9.33E-06 4.23E-14 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605162589 NA 2.25E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605162589 NA 5.55E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605162589 NA 6.46E-07 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605162589 5.88E-09 8.77E-17 mr1274 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605162589 NA 5.41E-08 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605162589 2.69E-09 1.05E-16 mr1201_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605162589 NA 3.00E-06 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605162589 1.58E-07 1.85E-14 mr1219_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605162589 NA 1.33E-08 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605162589 2.72E-08 1.21E-17 mr1274_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251