\
| Variant ID: vg0605126671 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5126671 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 94. )
ATATATACAAGTAAAGTATAAAGTTATGTTTTGGTTTGATACATATCAAGAGACGAAGGTCAATAACAAATCCATAAAGTCATTTCATTCATGTCTTTGT[G/A]
GTAGCTTCATGGGTTTCTCCACATCTTGTATATACAAGCAGCTCAAAATATGTGGTATTCCATATCATGATAAAAGTTATTTCTTCCTATTAAATTTATA
TATAAATTTAATAGGAAGAAATAACTTTTATCATGATATGGAATACCACATATTTTGAGCTGCTTGTATATACAAGATGTGGAGAAACCCATGAAGCTAC[C/T]
ACAAAGACATGAATGAAATGACTTTATGGATTTGTTATTGACCTTCGTCTCTTGATATGTATCAAACCAAAACATAACTTTATACTTTACTTGTATATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.70% | 26.10% | 1.02% | 12.17% | NA |
| All Indica | 2759 | 67.90% | 10.70% | 1.34% | 20.12% | NA |
| All Japonica | 1512 | 43.10% | 55.80% | 0.46% | 0.66% | NA |
| Aus | 269 | 75.50% | 22.30% | 1.49% | 0.74% | NA |
| Indica I | 595 | 59.30% | 3.20% | 2.02% | 35.46% | NA |
| Indica II | 465 | 68.20% | 25.80% | 0.43% | 5.59% | NA |
| Indica III | 913 | 71.10% | 4.30% | 2.19% | 22.45% | NA |
| Indica Intermediate | 786 | 70.40% | 14.90% | 0.38% | 14.38% | NA |
| Temperate Japonica | 767 | 56.20% | 42.90% | 0.78% | 0.13% | NA |
| Tropical Japonica | 504 | 23.60% | 74.80% | 0.00% | 1.59% | NA |
| Japonica Intermediate | 241 | 41.90% | 57.30% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 35.60% | 0.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605126671 | G -> A | LOC_Os06g10070.1 | upstream_gene_variant ; 3144.0bp to feature; MODIFIER | silent_mutation | Average:23.652; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0605126671 | G -> A | LOC_Os06g10050.1 | downstream_gene_variant ; 4336.0bp to feature; MODIFIER | silent_mutation | Average:23.652; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0605126671 | G -> A | LOC_Os06g10060.1 | downstream_gene_variant ; 904.0bp to feature; MODIFIER | silent_mutation | Average:23.652; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0605126671 | G -> A | LOC_Os06g10060-LOC_Os06g10070 | intergenic_region ; MODIFIER | silent_mutation | Average:23.652; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0605126671 | G -> DEL | N | N | silent_mutation | Average:23.652; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605126671 | NA | 2.08E-06 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605126671 | 1.53E-06 | 1.55E-13 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605126671 | NA | 8.72E-07 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605126671 | NA | 4.18E-12 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605126671 | 8.32E-06 | 2.61E-09 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605126671 | 1.01E-06 | 3.80E-13 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605126671 | 1.40E-06 | 1.90E-08 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605126671 | 5.93E-08 | 7.45E-15 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605126671 | NA | 6.00E-07 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605126671 | 4.63E-07 | 2.19E-13 | mr1219_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605126671 | 6.03E-07 | 1.93E-09 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605126671 | 3.33E-07 | 1.95E-15 | mr1274_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |