\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605126671:

Variant ID: vg0605126671 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5126671
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATATATACAAGTAAAGTATAAAGTTATGTTTTGGTTTGATACATATCAAGAGACGAAGGTCAATAACAAATCCATAAAGTCATTTCATTCATGTCTTTGT[G/A]
GTAGCTTCATGGGTTTCTCCACATCTTGTATATACAAGCAGCTCAAAATATGTGGTATTCCATATCATGATAAAAGTTATTTCTTCCTATTAAATTTATA

Reverse complement sequence

TATAAATTTAATAGGAAGAAATAACTTTTATCATGATATGGAATACCACATATTTTGAGCTGCTTGTATATACAAGATGTGGAGAAACCCATGAAGCTAC[C/T]
ACAAAGACATGAATGAAATGACTTTATGGATTTGTTATTGACCTTCGTCTCTTGATATGTATCAAACCAAAACATAACTTTATACTTTACTTGTATATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 26.10% 1.02% 12.17% NA
All Indica  2759 67.90% 10.70% 1.34% 20.12% NA
All Japonica  1512 43.10% 55.80% 0.46% 0.66% NA
Aus  269 75.50% 22.30% 1.49% 0.74% NA
Indica I  595 59.30% 3.20% 2.02% 35.46% NA
Indica II  465 68.20% 25.80% 0.43% 5.59% NA
Indica III  913 71.10% 4.30% 2.19% 22.45% NA
Indica Intermediate  786 70.40% 14.90% 0.38% 14.38% NA
Temperate Japonica  767 56.20% 42.90% 0.78% 0.13% NA
Tropical Japonica  504 23.60% 74.80% 0.00% 1.59% NA
Japonica Intermediate  241 41.90% 57.30% 0.41% 0.41% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 55.60% 35.60% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605126671 G -> A LOC_Os06g10070.1 upstream_gene_variant ; 3144.0bp to feature; MODIFIER silent_mutation Average:23.652; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0605126671 G -> A LOC_Os06g10050.1 downstream_gene_variant ; 4336.0bp to feature; MODIFIER silent_mutation Average:23.652; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0605126671 G -> A LOC_Os06g10060.1 downstream_gene_variant ; 904.0bp to feature; MODIFIER silent_mutation Average:23.652; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0605126671 G -> A LOC_Os06g10060-LOC_Os06g10070 intergenic_region ; MODIFIER silent_mutation Average:23.652; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0605126671 G -> DEL N N silent_mutation Average:23.652; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605126671 NA 2.08E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605126671 1.53E-06 1.55E-13 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605126671 NA 8.72E-07 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605126671 NA 4.18E-12 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605126671 8.32E-06 2.61E-09 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605126671 1.01E-06 3.80E-13 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605126671 1.40E-06 1.90E-08 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605126671 5.93E-08 7.45E-15 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605126671 NA 6.00E-07 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605126671 4.63E-07 2.19E-13 mr1219_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605126671 6.03E-07 1.93E-09 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605126671 3.33E-07 1.95E-15 mr1274_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251