\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605114474:

Variant ID: vg0605114474 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5114474
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGATTTATCTCCCGATGAGTTTCTCGATTCCAGTTGGGAGAAGTCGGGTGAACGGATTGTCAGAGACGTACGAGTCGATTCACGCCACCAGAACGGGCG[A/G]
CACCATTCGCGAGCCACTCGAAATACCAAATACTCGATGGGTCGAAAAATGCTGTGAAAAGTGCGTAGTTCGTGCGTGCAAGCAAAAGTACTACACCTGG

Reverse complement sequence

CCAGGTGTAGTACTTTTGCTTGCACGCACGAACTACGCACTTTTCACAGCATTTTTCGACCCATCGAGTATTTGGTATTTCGAGTGGCTCGCGAATGGTG[T/C]
CGCCCGTTCTGGTGGCGTGAATCGACTCGTACGTCTCTGACAATCCGTTCACCCGACTTCTCCCAACTGGAATCGAGAAACTCATCGGGAGATAAATCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 1.40% 1.97% 11.51% NA
All Indica  2759 79.10% 0.00% 1.85% 19.10% NA
All Japonica  1512 92.30% 4.40% 2.71% 0.60% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 62.70% 0.00% 2.69% 34.62% NA
Indica II  465 95.30% 0.00% 0.65% 4.09% NA
Indica III  913 75.80% 0.00% 2.41% 21.80% NA
Indica Intermediate  786 85.60% 0.00% 1.27% 13.10% NA
Temperate Japonica  767 87.10% 8.00% 4.95% 0.00% NA
Tropical Japonica  504 98.20% 0.20% 0.00% 1.59% NA
Japonica Intermediate  241 96.30% 2.10% 1.24% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 1.10% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605114474 A -> G LOC_Os06g10040.1 upstream_gene_variant ; 4065.0bp to feature; MODIFIER silent_mutation Average:63.914; most accessible tissue: Callus, score: 92.627 N N N N
vg0605114474 A -> G LOC_Os06g10030.1 downstream_gene_variant ; 4756.0bp to feature; MODIFIER silent_mutation Average:63.914; most accessible tissue: Callus, score: 92.627 N N N N
vg0605114474 A -> G LOC_Os06g10030-LOC_Os06g10040 intergenic_region ; MODIFIER silent_mutation Average:63.914; most accessible tissue: Callus, score: 92.627 N N N N
vg0605114474 A -> DEL N N silent_mutation Average:63.914; most accessible tissue: Callus, score: 92.627 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0605114474 A G 0.02 0.03 0.05 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605114474 NA 2.11E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0605114474 NA 7.00E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605114474 2.14E-06 2.14E-06 mr1750 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605114474 7.82E-06 5.71E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251