\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605049951:

Variant ID: vg0605049951 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5049951
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAGAAAAAAATATTTTGATACATTATGATTAAAGACCATATTGTCTCTAACTATTGTAGGGTGCTAGTCTCTAGATAATATAGAGCTCATATCTGACT[T/C]
TAACTTTGTACATGTCCTTAGCTATATATATTCCGATTCTTACTAAGGTTAAATTGATTTTATGTAAAAAGAATCCCTAAAAAGATTATGTGAAATTCTC

Reverse complement sequence

GAGAATTTCACATAATCTTTTTAGGGATTCTTTTTACATAAAATCAATTTAACCTTAGTAAGAATCGGAATATATATAGCTAAGGACATGTACAAAGTTA[A/G]
AGTCAGATATGAGCTCTATATTATCTAGAGACTAGCACCCTACAATAGTTAGAGACAATATGGTCTTTAATCATAATGTATCAAAATATTTTTTTCTTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 20.40% 0.32% 0.13% NA
All Indica  2759 72.20% 27.60% 0.11% 0.14% NA
All Japonica  1512 88.20% 11.00% 0.79% 0.07% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 57.60% 41.50% 0.50% 0.34% NA
Indica II  465 93.10% 6.90% 0.00% 0.00% NA
Indica III  913 70.60% 29.20% 0.00% 0.11% NA
Indica Intermediate  786 72.50% 27.40% 0.00% 0.13% NA
Temperate Japonica  767 86.60% 12.10% 1.30% 0.00% NA
Tropical Japonica  504 88.50% 11.10% 0.20% 0.20% NA
Japonica Intermediate  241 92.50% 7.10% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605049951 T -> C LOC_Os06g09900.1 upstream_gene_variant ; 3704.0bp to feature; MODIFIER silent_mutation Average:68.203; most accessible tissue: Minghui63 flower, score: 84.9 N N N N
vg0605049951 T -> C LOC_Os06g09910.1 downstream_gene_variant ; 4352.0bp to feature; MODIFIER silent_mutation Average:68.203; most accessible tissue: Minghui63 flower, score: 84.9 N N N N
vg0605049951 T -> C LOC_Os06g09910.2 downstream_gene_variant ; 4352.0bp to feature; MODIFIER silent_mutation Average:68.203; most accessible tissue: Minghui63 flower, score: 84.9 N N N N
vg0605049951 T -> C LOC_Os06g09900-LOC_Os06g09910 intergenic_region ; MODIFIER silent_mutation Average:68.203; most accessible tissue: Minghui63 flower, score: 84.9 N N N N
vg0605049951 T -> DEL N N silent_mutation Average:68.203; most accessible tissue: Minghui63 flower, score: 84.9 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605049951 NA 9.10E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0605049951 1.76E-11 4.62E-21 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 1.44E-08 1.86E-19 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 NA 7.37E-06 mr1201 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 1.98E-11 5.28E-18 mr1219 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 4.98E-08 5.80E-18 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 4.80E-11 6.21E-22 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 3.75E-08 6.28E-18 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 5.45E-11 4.73E-19 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 1.26E-09 8.94E-19 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 6.52E-11 1.04E-15 mr1219_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 2.12E-08 4.85E-16 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 1.11E-11 2.63E-21 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 3.58E-08 1.69E-18 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049951 NA 9.84E-07 mr1274_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251