\
| Variant ID: vg0604988139 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4988139 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, G: 0.06, others allele: 0.00, population size: 107. )
CGATTAAGTTTATAGAAAAATATAGTAGTATTTTCAACCCAAAACAAATATATTATTAAAATATATTCAATCTTAGATTTAATAAAACTAATTTGATATT[T/G]
TATATGTTTTTAATTTTTGCTATAAATTTAACCAGGAAAAAAGTCAAACGATTTATAATATGGAACGGAGGAAGTATATATGATATGAAATTTATGGTAC
GTACCATAAATTTCATATCATATATACTTCCTCCGTTCCATATTATAAATCGTTTGACTTTTTTCCTGGTTAAATTTATAGCAAAAATTAAAAACATATA[A/C]
AATATCAAATTAGTTTTATTAAATCTAAGATTGAATATATTTTAATAATATATTTGTTTTGGGTTGAAAATACTACTATATTTTTCTATAAACTTAATCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 43.90% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 36.90% | 63.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 85.50% | 14.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 44.40% | 55.10% | 0.50% | 0.00% | NA |
| Indica II | 465 | 36.30% | 63.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 32.40% | 67.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 36.90% | 63.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.80% | 14.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 87.90% | 12.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 20.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 35.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604988139 | T -> G | LOC_Os06g09790.1 | upstream_gene_variant ; 3080.0bp to feature; MODIFIER | silent_mutation | Average:19.359; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0604988139 | T -> G | LOC_Os06g09780-LOC_Os06g09790 | intergenic_region ; MODIFIER | silent_mutation | Average:19.359; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604988139 | NA | 2.43E-06 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604988139 | 5.73E-06 | 4.87E-13 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604988139 | NA | 5.25E-07 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604988139 | NA | 5.16E-12 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604988139 | 9.95E-07 | 5.91E-07 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604988139 | 4.57E-07 | 7.58E-13 | mr1274 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604988139 | NA | 9.21E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604988139 | 1.57E-06 | 4.58E-08 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604988139 | 4.70E-08 | 2.36E-14 | mr1201_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604988139 | NA | 2.09E-07 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604988139 | 1.41E-06 | 9.48E-12 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604988139 | 3.54E-08 | 2.59E-09 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604988139 | 9.90E-07 | 3.40E-13 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |