Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604872800:

Variant ID: vg0604872800 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4872800
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGCCGATCAAGGATCCCTGGAGTGTCAATCACTTGGTAGCGCAAATACTTGTAATCAGCATGACCAACAAACAGAGACTTAGTTGTGAAAGCATAAGG[C/T]
TGGACATCCACATCTGCTCTTGTGATCTTGTTCATGAAAGAGCTCTTCCCAACATTTGGATAGCCACAAATCAATAAAGTCCTGGTGTTTGGGTCTATAG

Reverse complement sequence

CTATAGACCCAAACACCAGGACTTTATTGATTTGTGGCTATCCAAATGTTGGGAAGAGCTCTTTCATGAACAAGATCACAAGAGCAGATGTGGATGTCCA[G/A]
CCTTATGCTTTCACAACTAAGTCTCTGTTTGTTGGTCATGCTGATTACAAGTATTTGCGCTACCAAGTGATTGACACTCCAGGGATCCTTGATCGGCCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.10% 22.90% 0.00% 0.00% NA
All Indica  2759 64.20% 35.80% 0.00% 0.00% NA
All Japonica  1512 95.30% 4.70% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 58.70% 41.30% 0.00% 0.00% NA
Indica II  465 73.50% 26.50% 0.00% 0.00% NA
Indica III  913 54.10% 45.90% 0.00% 0.00% NA
Indica Intermediate  786 74.70% 25.30% 0.00% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 90.70% 9.30% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604872800 C -> T LOC_Os06g09570.1 synonymous_variant ; p.Gln196Gln; LOW synonymous_codon Average:60.433; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604872800 8.67E-06 7.80E-12 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 1.68E-12 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 9.84E-09 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 3.18E-10 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 5.33E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 1.61E-14 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 2.82E-12 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 3.59E-06 mr1963 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 2.71E-10 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 3.46E-11 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 3.55E-08 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 3.92E-10 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 1.44E-06 3.06E-14 mr1274_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 1.22E-13 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 9.45E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604872800 NA 4.61E-07 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251