Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604840270:

Variant ID: vg0604840270 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4840270
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.43, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

TGTAGTAAAATACATCATTCCGCTAGTAAATGTATAATCTGCAACCTAAATTGAAGTTTTTTTCTTATGAAAACTAGCTGGGTGGCCCGCGCAATTGCGC[A/G]
GCTAGCACCCATATAAAATTATATATTTTTTAATATGATTTTACTTAAAATTTATTAAATAGAAGTCTCGATGTTTTAAGATTTTGAAAGACCAAACCTT

Reverse complement sequence

AAGGTTTGGTCTTTCAAAATCTTAAAACATCGAGACTTCTATTTAATAAATTTTAAGTAAAATCATATTAAAAAATATATAATTTTATATGGGTGCTAGC[T/C]
GCGCAATTGCGCGGGCCACCCAGCTAGTTTTCATAAGAAAAAAACTTCAATTTAGGTTGCAGATTATACATTTACTAGCGGAATGATGTATTTTACTACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.40%	17.00%	1.46%	37.07%	NA
All Indica	2759	71.10%	1.60%	1.16%	26.13%	NA
All Japonica	1512	6.00%	47.70%	1.12%	45.24%	NA
Aus	269	3.70%	4.50%	1.86%	89.96%	NA
Indica I	595	52.30%	1.70%	0.50%	45.55%	NA
Indica II	465	69.00%	1.50%	2.15%	27.31%	NA
Indica III	913	84.00%	1.20%	0.77%	14.02%	NA
Indica Intermediate	786	71.50%	2.20%	1.53%	24.81%	NA
Temperate Japonica	767	1.80%	81.50%	0.91%	15.78%	NA
Tropical Japonica	504	11.70%	4.40%	0.79%	83.13%	NA
Japonica Intermediate	241	7.10%	30.70%	2.49%	59.75%	NA
VI/Aromatic	96	5.20%	15.60%	9.38%	69.79%	NA
Intermediate	90	37.80%	13.30%	6.67%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604840270	A -> G	LOC_Os06g09500.1	upstream_gene_variant ; 3123.0bp to feature; MODIFIER	silent_mutation	Average:54.264; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0604840270	A -> G	LOC_Os06g09530.1	upstream_gene_variant ; 2104.0bp to feature; MODIFIER	silent_mutation	Average:54.264; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0604840270	A -> G	LOC_Os06g09490.1	downstream_gene_variant ; 4321.0bp to feature; MODIFIER	silent_mutation	Average:54.264; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0604840270	A -> G	LOC_Os06g09510.1	downstream_gene_variant ; 2035.0bp to feature; MODIFIER	silent_mutation	Average:54.264; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0604840270	A -> G	LOC_Os06g09520.1	downstream_gene_variant ; 142.0bp to feature; MODIFIER	silent_mutation	Average:54.264; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0604840270	A -> G	LOC_Os06g09540.1	downstream_gene_variant ; 4212.0bp to feature; MODIFIER	silent_mutation	Average:54.264; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0604840270	A -> G	LOC_Os06g09520-LOC_Os06g09530	intergenic_region ; MODIFIER	silent_mutation	Average:54.264; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0604840270	A -> DEL	N	N	silent_mutation	Average:54.264; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604840270	8.35E-07	NA	mr1201	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604840270	NA	6.26E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251