\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604786256:

Variant ID: vg0604786256 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4786256
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TGCACCAACGGTCCTTAAACTTGTCAGGAGGTTTCATTTAGGTCCACGAACTTGCAAAGCGCACATCGAGGTCCCTAAACTTGGTTTATTATATCATCCC[G/A]
GTCCAAAGCCACGTTTGACCGTGGTCTTACCTGCGTGGCATGCCACGTGGACGATGACATGGAATTTTTTTATTTTTTTCTCCCTCCTTCCTTCTTTTTT

Reverse complement sequence

AAAAAAGAAGGAAGGAGGGAGAAAAAAATAAAAAAATTCCATGTCATCGTCCACGTGGCATGCCACGCAGGTAAGACCACGGTCAAACGTGGCTTTGGAC[C/T]
GGGATGATATAATAAACCAAGTTTAGGGACCTCGATGTGCGCTTTGCAAGTTCGTGGACCTAAATGAAACCTCCTGACAAGTTTAAGGACCGTTGGTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.00% 22.80% 0.21% 0.00% NA
All Indica  2759 66.30% 33.40% 0.33% 0.00% NA
All Japonica  1512 94.90% 5.00% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 55.00% 44.70% 0.34% 0.00% NA
Indica II  465 86.50% 13.30% 0.22% 0.00% NA
Indica III  913 63.10% 36.70% 0.22% 0.00% NA
Indica Intermediate  786 66.70% 32.80% 0.51% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 90.30% 9.70% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 5.80% 0.41% 0.00% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604786256 G -> A LOC_Os06g09430.1 downstream_gene_variant ; 1901.0bp to feature; MODIFIER silent_mutation Average:30.049; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0604786256 G -> A LOC_Os06g09420-LOC_Os06g09430 intergenic_region ; MODIFIER silent_mutation Average:30.049; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604786256 4.14E-07 3.67E-13 mr1201 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604786256 1.28E-06 1.71E-13 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604786256 4.04E-06 1.31E-09 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604786256 NA 1.70E-11 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604786256 NA 4.06E-11 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604786256 NA 3.33E-11 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604786256 8.14E-06 2.24E-10 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604786256 NA 2.70E-10 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604786256 NA 6.27E-08 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604786256 NA 4.22E-09 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604786256 6.50E-06 1.29E-10 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604786256 NA 9.79E-11 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251