\
| Variant ID: vg0604777948 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4777948 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )
TTCCTGACACATCACATTCCTACTCATCATGCAACTTCCATCAGCAGATAAGTTGCAGATAGATCAACCCGTGCATCGAATTATTGAAATCGATCATTGT[G/A]
TGTTGGTATGTATATATGATGAATCTCTCTGAAGTATGTACCTTTTTCCTCCCCTAATGCAAGCTGGTGGTTCCTTTGGTATATATCTTGATTCTTGAGG
CCTCAAGAATCAAGATATATACCAAAGGAACCACCAGCTTGCATTAGGGGAGGAAAAAGGTACATACTTCAGAGAGATTCATCATATATACATACCAACA[C/T]
ACAATGATCGATTTCAATAATTCGATGCACGGGTTGATCTATCTGCAACTTATCTGCTGATGGAAGTTGCATGATGAGTAGGAATGTGATGTGTCAGGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.30% | 22.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 55.00% | 45.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.90% | 13.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 63.60% | 36.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 67.00% | 33.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 35.40% | 64.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604777948 | G -> A | LOC_Os06g09420-LOC_Os06g09430 | intergenic_region ; MODIFIER | silent_mutation | Average:44.061; most accessible tissue: Zhenshan97 flower, score: 74.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604777948 | 1.91E-06 | 3.54E-12 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604777948 | 6.82E-06 | 6.35E-13 | mr1201 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604777948 | NA | 6.01E-09 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604777948 | NA | 4.88E-11 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604777948 | NA | 9.07E-11 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604777948 | NA | 6.88E-11 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604777948 | NA | 1.58E-09 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604777948 | NA | 7.38E-10 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604777948 | NA | 2.34E-07 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604777948 | NA | 1.04E-08 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604777948 | NA | 3.39E-10 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604777948 | NA | 1.62E-10 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604777948 | NA | 9.40E-06 | mr1406_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |