\
| Variant ID: vg0604726687 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4726687 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGAATAAAATTTTTATATACGTGTTCCTAGCGATCTAAAAATAAAGGCTGAAAATAAACTTCAATGAAAAAACCCTAAAATTAACTTCAAATTTAAGATT[A/G]
AAAATTTAAATTTTAGCTGATAAGTACTCCCTCCGGGTTGATAATACTTGTCGTTTTGGACAAGGGCACGTCTAAAAAAACAACTTTGACCATTATTTTC
GAAAATAATGGTCAAAGTTGTTTTTTTAGACGTGCCCTTGTCCAAAACGACAAGTATTATCAACCCGGAGGGAGTACTTATCAGCTAAAATTTAAATTTT[T/C]
AATCTTAAATTTGAAGTTAATTTTAGGGTTTTTTCATTGAAGTTTATTTTCAGCCTTTATTTTTAGATCGCTAGGAACACGTATATAAAAATTTTATTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.10% | 15.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 89.80% | 10.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 69.20% | 30.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.10% | 25.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.50% | 4.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 89.10% | 10.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604726687 | A -> G | LOC_Os06g09390.1 | upstream_gene_variant ; 4643.0bp to feature; MODIFIER | silent_mutation | Average:51.848; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0604726687 | A -> G | LOC_Os06g09390.2 | upstream_gene_variant ; 4643.0bp to feature; MODIFIER | silent_mutation | Average:51.848; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0604726687 | A -> G | LOC_Os06g09380-LOC_Os06g09390 | intergenic_region ; MODIFIER | silent_mutation | Average:51.848; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604726687 | NA | 1.30E-13 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0604726687 | NA | 2.54E-16 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0604726687 | 1.76E-07 | NA | mr1115 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | 5.51E-06 | NA | mr1115 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | 9.22E-06 | NA | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | 5.40E-06 | 5.82E-14 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | NA | 4.41E-07 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | NA | 5.21E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | NA | 2.50E-07 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | 2.58E-08 | NA | mr1611 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | NA | 4.13E-11 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | 1.18E-08 | NA | mr1920 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | NA | 2.11E-13 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | NA | 4.48E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | NA | 3.43E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | NA | 8.29E-09 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604726687 | NA | 4.69E-09 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |