Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604645812:

Variant ID: vg0604645812 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4645812
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

GAAACGTACGCGGCTCTGCCACTCTTAGCACCACCTCCATCCTCACGATGACGAGCCCCACCAGTCACAACCTTTTTTAGTTTTCCCTCTTATCTTTCTT[C/T]
ATGATGTTATCGTCACCTATGTGGCTATGTTCAAACTCCGAAGCTTTATCCCCGACCAACCTCTCCTTCCCAGTCTTCGATTGAGCGAGACGCCAGATCC

Reverse complement sequence

GGATCTGGCGTCTCGCTCAATCGAAGACTGGGAAGGAGAGGTTGGTCGGGGATAAAGCTTCGGAGTTTGAACATAGCCACATAGGTGACGATAACATCAT[G/A]
AAGAAAGATAAGAGGGAAAACTAAAAAAGGTTGTGACTGGTGGGGCTCGTCATCGTGAGGATGGAGGTGGTGCTAAGAGTGGCAGAGCCGCGTACGTTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	46.70%	0.06%	0.00%	NA
All Indica	2759	22.00%	78.00%	0.00%	0.00%	NA
All Japonica	1512	98.50%	1.30%	0.13%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	26.10%	73.90%	0.00%	0.00%	NA
Indica II	465	31.60%	68.40%	0.00%	0.00%	NA
Indica III	913	11.80%	88.20%	0.00%	0.00%	NA
Indica Intermediate	786	25.20%	74.80%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	96.40%	3.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.40%	0.83%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604645812	C -> T	LOC_Os06g09230.2	upstream_gene_variant ; 711.0bp to feature; MODIFIER	silent_mutation	Average:55.605; most accessible tissue: Callus, score: 77.656	N	N	N	N
vg0604645812	C -> T	LOC_Os06g09240.1	upstream_gene_variant ; 2142.0bp to feature; MODIFIER	silent_mutation	Average:55.605; most accessible tissue: Callus, score: 77.656	N	N	N	N
vg0604645812	C -> T	LOC_Os06g09250.1	downstream_gene_variant ; 3769.0bp to feature; MODIFIER	silent_mutation	Average:55.605; most accessible tissue: Callus, score: 77.656	N	N	N	N
vg0604645812	C -> T	LOC_Os06g09230-LOC_Os06g09240	intergenic_region ; MODIFIER	silent_mutation	Average:55.605; most accessible tissue: Callus, score: 77.656	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604645812	NA	7.93E-08	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604645812	NA	1.72E-10	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604645812	NA	6.96E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604645812	NA	4.31E-08	mr1611	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604645812	NA	2.71E-07	mr1920	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604645812	NA	4.23E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604645812	NA	1.16E-09	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604645812	NA	1.03E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604645812	NA	5.60E-06	mr1654_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604645812	NA	7.10E-09	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251