\
| Variant ID: vg0604645812 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4645812 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 263. )
GAAACGTACGCGGCTCTGCCACTCTTAGCACCACCTCCATCCTCACGATGACGAGCCCCACCAGTCACAACCTTTTTTAGTTTTCCCTCTTATCTTTCTT[C/T]
ATGATGTTATCGTCACCTATGTGGCTATGTTCAAACTCCGAAGCTTTATCCCCGACCAACCTCTCCTTCCCAGTCTTCGATTGAGCGAGACGCCAGATCC
GGATCTGGCGTCTCGCTCAATCGAAGACTGGGAAGGAGAGGTTGGTCGGGGATAAAGCTTCGGAGTTTGAACATAGCCACATAGGTGACGATAACATCAT[G/A]
AAGAAAGATAAGAGGGAAAACTAAAAAAGGTTGTGACTGGTGGGGCTCGTCATCGTGAGGATGGAGGTGGTGCTAAGAGTGGCAGAGCCGCGTACGTTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.20% | 46.70% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 22.00% | 78.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.50% | 1.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 26.10% | 73.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 31.60% | 68.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 11.80% | 88.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 25.20% | 74.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604645812 | C -> T | LOC_Os06g09230.2 | upstream_gene_variant ; 711.0bp to feature; MODIFIER | silent_mutation | Average:55.605; most accessible tissue: Callus, score: 77.656 | N | N | N | N |
| vg0604645812 | C -> T | LOC_Os06g09240.1 | upstream_gene_variant ; 2142.0bp to feature; MODIFIER | silent_mutation | Average:55.605; most accessible tissue: Callus, score: 77.656 | N | N | N | N |
| vg0604645812 | C -> T | LOC_Os06g09250.1 | downstream_gene_variant ; 3769.0bp to feature; MODIFIER | silent_mutation | Average:55.605; most accessible tissue: Callus, score: 77.656 | N | N | N | N |
| vg0604645812 | C -> T | LOC_Os06g09230-LOC_Os06g09240 | intergenic_region ; MODIFIER | silent_mutation | Average:55.605; most accessible tissue: Callus, score: 77.656 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604645812 | NA | 7.93E-08 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604645812 | NA | 1.72E-10 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604645812 | NA | 6.96E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604645812 | NA | 4.31E-08 | mr1611 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604645812 | NA | 2.71E-07 | mr1920 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604645812 | NA | 4.23E-14 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604645812 | NA | 1.16E-09 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604645812 | NA | 1.03E-12 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604645812 | NA | 5.60E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604645812 | NA | 7.10E-09 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |